SGN Marker TG297

SGN-M266

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2500
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
ATGACCAGAATAGTCAATAGGCTACATATAACCCTATAGCAATAACCTCACATTAGTAAACACATCTCAATCATAACTACTCAGAGAAAC
CTAGATGAATAATTTATCACATAAGCTACTATTATGTAGCACAAAATGGACTTCTATATAATGAATACTGCACCTCAAACAAGAAAACAG
AAAAATCTACAAATGTGTCACCATCACAATAAATGGGAAATGGCATAGTCAATACATTTGGGGAACACTATCAAAGAAAAGGTAGACTAC
TTGTAATACTGCAAAAGGTCCAATTCAAAAGCAGAGAGCAAGGTCTTATGTTTAAACTTGAACATTCCTGCACCCCAACCTCTAAACAAA
GGAAAAAGGTAGGCTTTTTGTCAGGTAAAGCTAATGGGTTCGATGAATTTTAGCCCATATCAACATCTGGTGACTGAACACTTTCAGGTC
TTAGTTCTTCAGAAAAGTGAATAATGTGAAGGACATGTATTACCGTTGACTATTTGAGATCC
Reverse sequence
TGTCTCTTTCGTTAGTGGAAATTTGAAAAAAGGAAGAAGAAAGAGGCTCTCAATCTTCAGTATGGTAAGCTATGTGTTGTCTTTATCTAT
TGGCAGTGCTTTCTTGAAGTGGTGCTAAGAAATAGGAACTTGTGTATTGAAAATCTTGAACTTCTTGTTTTTGCTATTTTACAGGATTTG
TTTAGGCAGGCTATTCTTCGACAAGGGCCACCTGAAGAATTCGCTCTTCTAACTGTTCAAGAAGCTATAAAACCTCAGGTTTCTATATAC
ACCCTTTTATCTTTTCTATGTGTGTGCCCTAATTTCTTGATTTCGTAAAACACAACACAAACAAATTCCTGAGATTGTTACTTCCAAGAA
AAGAACTAAATCTCTTCTATATGTGTGCCCTAATTTCTCTTGCACAAAGAAATTCCTTACAAGAAAAGAACTAAGCTATACAAAGTTGTC
CTACTTTATGTTTTGCATAAAACTGCTTCAAGATTGTGTAAATT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1542351.2e-2965 (13.2% of RFLP seq)-
SGN-U1542353.4e-3985 (17.2% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39985)
Chromosome
6
Position
4.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8761)
Chromosome
6
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG297 was used as an overgo probe on plate 2 [well A7]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P185G24,   P050P19,   P234D05,   P080J18,   P320K06,   P249M15,   P316N21,   P076E08,   P025H01,   P329B17,   P160N24

 Overgo Sequences

A sequence
AGCCCATATCAACATCTGGTGACT
B sequence
AGACCTGAAAGTGTTCAGTCACCA
AB sequence
AGCCCATATCAACATCTGGTGACTGAACAC
Marker sequence
ATGACCAGAATAGTCAATAGGCTACATATAACCCTATAGCAATAACCTCA
CATTAGTAAACACATCTCAATCATAACTACTCAGAGAAACCTAGATGAAT
AATTTATCACATAAGCTACTATTATGTAGCACAAAATGGACTTCTATATA
ATGAATACTGCACCTCAAACAAGAAAACAGAAAAATCTACAAATGTGTCA
CCATCACAATAAATGGGAAATGGCATAGTCAATACATTTGGGGAACACTA
TCAAAGAAAAGGTAGACTACTTGTAATACTGCAAAAGGTCCAATTCAAAA
GCAGAGAGCAAGGTCTTATGTTTAAACTTGAACATTCCTGCACCCCAACC
TCTAAACAAAGGAAAAAGGTAGGCTTTTTGTCAGGTAAAGCTAATGGGTT
CGATGAATTTTAGCCCATATCAACATCTGGTGACTGAACACTTTCAGGTC
TTAGTTCTTCAGAAAAGTGAATAATGTGAAGGACATGTATTACCGTTGAC
TATTTGAGATCC
Genomic location of TG297  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D266 marker 266
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)