SGN Marker TG339

SGN-M27

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1290
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG339 image not available
Forward sequence
CATTATTCAGCAGAAACAACAACATAGTAGCGTAATCCCACAGTTTATACAGAAACCTTACCCCTCTAACTACTGAGGTAAACATAGATC
TATCATATGCTTTGTAAATGCCTACCAAAAAAAGGGCCTCTATTAAAACAGATGGAATATTAAGTCATATTCTTCTTTAAAAACCCAAGC
TAAAGGTATGGATGGATATGTACTTACTGCCTTCAATAAAGTTTAATCTTGACTTGATACAAAATTAATAGACACATATCCAAGTGAACA
AAATGGAGTAGACAATCAAAATGCAGAATATGAAGGAAGATCAATCCACAATGCTCTACTTCTTCGAGAAAAAGGAAATAAAAAGTACTA
CTTGCTTCGTGAAAATAAATATTCATTTCCACGAAATAAGAGAGCTTCATCAGAGCATCCAAATACAAGAGAAATACGTAGACAAAAGGT
AATCTTTGATGAAAACAACAAATGGCAAGAAACAGCGCCTTTAGGTAATAGGTATTACAAATCACAGGATAAGGACTACAAACAGCCAAT
TTTGATCAATGAGTAAAATTACATCATCGGTTGTCAATTCTAAGCAAAGAAGTTTCACTCACGATGTTACTACTCATTATCAGCTTTTGA
TGGTTCTTTGATCTCATCAGTTCCATCATCCT
Reverse sequence
AGAATACTCTTTCGGCCTACAAGTCTGCTCAGGTATTTAGACTTTCATTCTTTATAAAATGTGGAGGAAAATCTCATATGAGTTCTGCGA
ACGGGAATGTTCTATGTGTGTTAAATTAGGAAATTGCATAAACAAGTACTGCAAGTCACCATTTTTATTTAGAAGAGTAACCAAAATCCA
TTAGAATTCGTCGTCCAAGGGAAAAAAATGTTTCCCGTGGTGAACCATGTAGTATTATTTAATCGAAGCATGAACATGACGTCTCTCTCT
TTTTCAGGATATCGCTAATGGCGAATTGGCCCCAACACATCCAATCCGATTGGGTCTAGCTCTCAATTTCTCAGTGTTTTACTATGAGAT
ATTGAATTCTCCTGATCGTGCTTGTAATCTCGCCAAACAGGTAACAAATTTATTGTATTCCTTGTTTCTTAATTGAGCATCCAGGGTGAT
TTTGGAAAGAAAAATAGATGTTTGTGTCTATTCAATGATGTTTATGGTTTGTATGGTTGTGTAATATGCCTTTGATGAGGCAATTGCGGA
GCTTGACACCCTGGGAGAGGAGTCCTACAAGGATAGCACTTTGATTATGCAACTTCTGCG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1436354.9e-0829 (4.4% of RFLP seq)+
SGN-U1436366e-168297 (44.9% of RFLP seq)+
SGN-U1467374.2e-0568 (11.3% of RFLP seq)-
SGN-U1442474.2e-0580 (13.3% of RFLP seq)-
SGN-U1442401.1e-0541 (6.8% of RFLP seq)-
SGN-U1436361.8e-1033 (5.5% of RFLP seq)-
SGN-U1436351.2e-1480 (13.3% of RFLP seq)-
SGN-U1443183e-1577 (12.8% of RFLP seq)-
SGN-U1443174.9e-1780 (13.3% of RFLP seq)-
SGN-U1443178e-19103 (17.2% of RFLP seq)-
SGN-U1443182.1e-22101 (16.8% of RFLP seq)-
SGN-U1436352.4e-3497 (16.2% of RFLP seq)-
SGN-U1436362.6e-4083 (13.8% of RFLP seq)-
SGN-U1436363.7e-67128 (21.3% of RFLP seq)-
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53887)
Chromosome
4
Position
45.00 cM
Confidence
uncalculated
Protocol
RFLP

2_Isobutylthiazole_content_ibt4_1 2_Methylthio_ethanol_content_meo4_1 Dry_matter_weight_dmw4_1 6_Methylhept_5_en_2_one_content_mhn4_1 Lycopene_content_lyc4_1 2_Methylbut_2_enal_content_bea4_1Color_L_L4_1 Color_a_a4_1Hexanal_content_hxa4_1 3_Methylpentan_1_ol_content_mno4_1 Elasticity_ela4_1 Color_b_b4_1Firmness_fir4_1
Tomato QTL map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53274)
Chromosome
4
Position
31.26 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_4 MQTL_1_Late_blight_5.2 MQTL_2_Late_blight_4
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42441)
Chromosome
11
Position
109.50 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Eggplant-LXM 2002   
Map version
29 (location: 7798)
Chromosome
11
Position
114.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7797)
Chromosome
4
Position
31.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG339 was used as an overgo probe on plate 10 [well B5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GTTCCATCATCCTGAGTGGAGAAG
B sequence
AGGTGATCCTTCTCCGCTTCTCCA
AB sequence
GTTCCATCATCCTGAGTGGAGAAGCGGAGA
Marker sequence
CATTATTCAGCAGAAACAACAACATAGTAGCGTAATCCCACAGTTTATAC
AGAAACCTTACCCCTCTAACTACTGAGGTAAACATAGATCTATCATATGC
TTTGTAAATGCCTACCAAAAAAAGGGCCTCTATTAAAACAGATGGAATAT
TAAGTCATATTCTTCTTTAAAAACCCAAGCTAAAGGTATGGATGGATATG
TACTTACTGCCTTCAATAAAGTTTAATCTTGACTTGATACAAAATTAATA
GACACATATCCAAGTGAACAAAATGGAGTAGACAATCAAAATGCAGAATA
TGAAGGAAGATCAATCCACAATGCTCTACTTCTTCGAGAAAAAGGAAATA
AAAAGTACTACTTGCTTCGTGAAAATAAATATTCATTTCCACGAAATAAG
AGAGCTTCATCAGAGCATCCAAATACAAGAGAAATACGTAGACAAAAGGT
AATCTTTGATGAAAACAACAAATGGCAAGAAACAGCGCCTTTAGGTAATA
GGTATTACAAATCACAGGATAAGGACTACAAACAGCCAATTTTGATCAAT
GAGTAAAATTACATCATCGGTTGTCAATTCTAAGCAAAGAAGTTTCACTC
ACGATGTTACTACTCATTATCAGCTTTTGATGGTTCTTTGATCTCATCAG
TTCCATCATCCT
Genomic location of TG339  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D27 marker 27
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)