SGN Marker cLEC-10-C3

SGN-M2910

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C942
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40271)
Chromosome
1
Position
21.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLEC-10-C3 was used as an overgo probe on plate 3 [well E2]

Plausible BAC Matches:   P263P17,   P095M15

 Overgo Sequences

A sequence
AGCCGTTGGAAACGAAGTTGATCC
B sequence
ACCACTGTCTCTACCTGGATCAAC
AB sequence
AGCCGTTGGAAACGAAGTTGATCCAGGTAG
Marker sequence
TTTCTTACTCTTCTCAATTTCCAATTTTGCTATGGCTTTTCTAAGTTCTC
TCTTAGCTTCCCTTTTACTTGTTGGGCTTCTAATCCAAATAACAGGAGCG
CAGCCTATCGGAGTATGTTATGGAAAAATTGCCAATAATTTACCATCGGA
TCAAGATGTCATAAAATTATATAATTCGAATAACATCAAGAAAATGAGAA
TTTACTTTCCAGAAACAAATGTCTTTAATGCCCTCAAAGGAAGTAACATT
GAAATAATTCTTGATGTCCCAAATCAAGATCTTGAAGCCCTAGCCACTCC
TTCAAACGCCAACGGTTGGGTTCAAGATAATATAAGAAATCATTTTCCGG
ATGTTAAATTCAAATATATAGCCGTTGGAAACGAAGTTGATCCAGGTAGA
GACAGTGGTAAATACGCACGATTTGTTGGTCCAGCAATGGAAAATATTTA
CAACGCGTTATCATCAGCAGGGTTGCAAAATCAAAATAA
Genomic location of cLEC-10-C3  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2910 marker 2910
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)