Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker cLES-5-J1

SGN-M2925

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C78406
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51082)
Chromosome
1
Position
77.08 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49018)
Chromosome
1
Position
68.08 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40357)
Chromosome
1
Position
65.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLES-5-J1 was used as an overgo probe on plate 3 [well B7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TTTTCGAGGACCAAGCAAGGCCTT
B sequence
AGGCGGTCTTGTTGATAAGGCCTT
AB sequence
TTTTCGAGGACCAAGCAAGGCCTTATCAAC
Marker sequence
TTTTCGAGGACCAAGCAAGGCCTTATCAACAAGACCGCCTCACTCCCTCC
CATATTGTATTACAACTTACAAGATTGAACAAACAGCTCAGACGCTACCA
ATAAACTGTTCCATCTTATAGGTGGTGTAAATTTCAAGGCAAAGACGCTG
TGGCACGAATCCCCTATTTGTAGAGTAAAATGAGTGCCTTGGATGCAGCC
AGAGCAGAGCTTGCCCTTGCAGTCTTGTACTTGAACAAAGCAGAGGCAAG
GGACAAGATATGCAGGGCAATACAGTATGGTTCAAAATTTGTGAGTAATG
GAGAGCCTGGCACTGCTCAAAATGTTGACAAATCAACTAGCTTAGCAAGG
AAAGTATTCCGTCTTTTCAAGTTCATCAATGATCTGCACGGGCTTATTAG
TCCACCTGCCCCAGGAACCCCACTTCCACTCATCTTGTT
Genomic location of cLES-5-J1  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2925 marker 2925
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)