SGN Marker cLEC-7-H4

SGN-M3010

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C14302
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51064)
Chromosome
2
Position
42.29 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49000)
Chromosome
2
Position
94.48 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40286)
Chromosome
2
Position
87.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLEC-7-H4 was used as an overgo probe on plate 11 [well C6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GACGCTAAGATCTCTCTCATCATG
B sequence
TCCTGGTGCTTGATAGCATGATGA
AB sequence
GACGCTAAGATCTCTCTCATCATGCTATCA
Marker sequence
CCTCTCTTTAACTTCAACAATGAACATGACCCTTGTTGATTCACCTCAAT
TTCTACTTCTTCAAAAATGGGCCGTGGAAAAATTGAGATCAAGAAGATTG
AAAACTCGACAAACAGGCAGGTCACTTACTCCAAGAGAAGAAACGGTATT
TTCAAGAAAGCTAAAGAACTTACTGTTCTTTGTGACGCTAAGATCTCTCT
CATCATGCTATCAAGCACCAGGAAGTATCATGAGTACACAAGCCCAAACA
CTACGACAAAAAAGATGATTGATCAGTATCAGAGTGCACTTGGAGTTGAT
ATCTGGAGCATTCACTACGAGAAAATGCAAGAAAACTTGAAGAGATTGAA
AGAGATCAATAACAAGCTAAGAAGAGAGATAAGGCAGAGAACAGGGGAAG
ACATGAGCGGACTAAATTTGCAGGAACTATGTCACTTGCAGGAGAACATC
ACTGAATCTGTTGCTGAGATTCGTGAACGAAAGTACCACGTGATC
Genomic location of cLEC-7-H4  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3010 marker 3010
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)