SGN Marker cLED-19-B24

SGN-M3012

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C17247
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40300)
Chromosome
2
Position
100.00 cM
Confidence
F(LOD3)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40301)
Chromosome
2
Position
90.00 cM
Confidence
CF(LOD3)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLED-19-B24 was used as an overgo probe on plate 11 [well E10]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GCTTCTCCTTCTTCCTAGTCGATC
B sequence
TTCGGATTCGTGCAGAGATCGACT
AB sequence
GCTTCTCCTTCTTCCTAGTCGATCTCTGCA
Marker sequence
TGACTTTTACCTTTGCTGCCTCTTCTTGTTTTTTTCATCCATTTCTGCTT
CTCCTTCTTCCTAGTCGATCTCTGCACGAATCCGAAAAAACCCCTTTTTT
TTGGAAATAGTTAGCTATGACTCTTGGTTCAGGAGGATCTAGTGTTGTGG
TCCCTCGGAATTTCAGATTACTTGAGGAACTTGAACGTGGTGAAAAGGGT
ATTGGAGATGGGACTGTAAGCTATGGGATGGATGATGGAGATGATATCTA
TATGCGTTCCTGGACTGGCACCATTATTGGTCCTCACAATTCCGTTCATG
AAGGTCGCATTTATCAGTTGAAGTTATTCTGTGATAAAGATTATCCAGAG
AAGCCACCTAGTGTCCGCTTCCATTCTCGAGTTAACATGACATGTGTCAA
CCATGAGACAGGAGTGGTGGAACCAAAAAGTTTGCTTTACTTGCAAATTG
GGAGCGAGAGTTCACCATGGAAGACATACTGGTTCAGCTGAAA

cLED-19-B24 was used as an overgo probe on plate 11 [well B11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCTTCTCCTTCTTCCTAGTCGATC
B sequence
TTCGGATTCGTGCAGAGATCGACT
AB sequence
GCTTCTCCTTCTTCCTAGTCGATCTCTGCA
Marker sequence
TGACTTTTACCTTTGCTGCCTCTTCTTGTTTTTTTCATCCATTTCTGCTT
CTCCTTCTTCCTAGTCGATCTCTGCACGAATCCGAAAAAACCCCTTTTTT
TTGGAAATAGTTAGCTATGACTCTTGGTTCAGGAGGATCTAGTGTTGTGG
TCCCTCGGAATTTCAGATTACTTGAGGAACTTGAACGTGGTGAAAAGGGT
ATTGGAGATGGGACTGTAAGCTATGGGATGGATGATGGAGATGATATCTA
TATGCGTTCCTGGACTGGCACCATTATTGGTCCTCACAATTCCGTTCATG
AAGGTCGCATTTATCAGTTGAAGTTATTCTGTGATAAAGATTATCCAGAG
AAGCCACCTAGTGTCCGCTTCCATTCTCGAGTTAACATGACATGTGTCAA
CCATGAGACAGGAGTGGTGGAACCAAAAAGTTTGCTTTACTTGCAAATTG
GGAGCGAGAGTTCACCATGGAAGACATACTGGTTCAGCTGAAA
Genomic location of cLED-19-B24  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3012 marker 3012
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)