SGN Marker cLEC-7-L24

SGN-M3018

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C14380
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40287)
Chromosome
2
Position
111.20 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLEC-7-L24 was used as an overgo probe on plate 11 [well G1]

Plausible BAC Matches:   P124N09

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GTGCAACCTTGTCAAGAAGCCTGA
B sequence
TACTTGGTCCAAGCTCTCAGGCTT
AB sequence
GTGCAACCTTGTCAAGAAGCCTGAGAGCTT
Marker sequence
GATCTTGAGTGCGTTTTCACAATAATGTGCAACCTTGTCAAGAAGCCTGA
GAGCTTGGACCAAGTACATGAGATGGCAGAGCTCATATCCGCTAAAATCA
TTCAACAACCCAATGATAAACCCGCATTGCGCTTGAAAATCTTGTTCAAT
CTCTACAATCTGTTGGAGAACCCATACAGCCGTTTCTGCGTTTACTTGAA
GTCCCTCAAGTTGGCCACTGCCGGGAAGGTTACTGAACACATTTTGTCGT
CCATCAAAATGATGGATAACTTCTTGAAGGAGTGGAATCTTGGAGTCAAA
GATCAGAGAGAGCTGTTTCTTGCAATCTCCAACATTTTAAAGGAAAGCAC
AGGCTCTACANAAGATTCTTTCATGTTTCTTACAAAGTATCTGGAAACCT
TTTCGTCTGAAGATGCTTCTAATATGACTGAAGCTAAAGAAGAAGCTGCC
AGTGCAATTGTCGATTTTGTCAGATCACCTGATATGTTTAAGGGTGACTT
GCT
Genomic location of cLEC-7-L24  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3018 marker 3018
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)