SGN Marker cLET-8-K6

SGN-M3028

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C88570
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40425)
Chromosome
3
Position
0.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-8-K6 was used as an overgo probe on plate 2 [well A6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TATCGGCGTTATCGGTGACGGTAA
B sequence
ACACACTCTACGTCGTTTACCGTC
AB sequence
TATCGGCGTTATCGGTGACGGTAAACGACG
Marker sequence
CGCACGTCATATTCACGTCTCCGTTCCAGTGACCCAATTCCCCAAAAAAT
ATTGTGCATTACCAAAATTCCGGCGAGAACGAATTGTTATTCGTCGGACG
GGATGGAAATCGGAGACGGAGTGAAGTGCTCCAAGGTATTAGCTTTGGTA
GCTATTTTATTATTCAGCTTCGTCGGCGACCTATCGGCGTTATCGGTGAC
GGTAAACGACGTAGAGTGTGTTCAGGATTACGTGTTGTATGAAGGAGATA
CAATTTCGGGGAACTTCGTTGTTGTAGATCATGATATCTTCTGGAACTCG
GATCATCCCGGCATTGATTTCACTGTGGCATCGCCTTCAGGAAATGTCGT
GCACACAATGAAGGGAACAGCTGGTGATAAGTTTGAACTCAAGGCCCCAA
AGAGTGGGATGTACAATTTCTGTTTTCATAATCCACATTCATCGCCAGAA
ACAGTCTCGTTCTACATACATATTGGACACATTTCCAATGAGCATGACCT
TGCTAAAGATGAACATTTGGACCCCGTCAATGTC
Genomic location of cLET-8-K6  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3028 marker 3028
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)