SGN Marker TG533

SGN-M303

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2100
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG533 image not available
Forward sequence
TTGTTCTTGATGTTTTTTTAGTAGTATGACGGGTGTAAAGATTACTTATGTAGTTCATATATATATAAATAAAAAAGTTTGACAACTTCA
AAATTTTGGATGCAAGTTCTTAGTATTGATATGCAAAAAAAATTATGATGAAAACTAATAATAGGTAATTTGGTAAAACTGATGCAGTTT
ACGTAGTGTACTCAGTATTCAAGATTATTTTATTAAAATAAAAATTGCTGTAAAAAACAATCATATACATATATAGAGTAAAACAAAAAG
TTAATAATTAAATTATTTTTGATAAAATAAAGGTCATTATTTTTAACATGCTAACAATAAAAAGTGTGTTCCAGCAGTTGAGACATACGG
ACTAACTTGCTACATTATTATTATATTATTAATAGGTTGCTAGGAAATTGTTTACGTAAAAATTAAATACCGTATATATATCGTATAAAT
ATATTATAATTGATAGTTGATTAGTAGATAAATTGTTCATATATATTGTGTTTG
Reverse sequence
GGAGACAGCTTGCATGCCTGCAGTTCAATAAAACTGGTGTTCCTTCAACATCCACCATAACATTCATAAAATTGTTCCCTTGTATCAGTT
TTAAATTTTACCAAAATTAGAGCTACAACTTAAAAAGATATAATGCATATTTATGTGGAGCATGCAAGGGCAGATATAGATATATCCTAA
CAAAACCAAGTCTATACCCGAGACCTTTTGTCCAACTGCACTGGTAACACTTTTAAGTCCCAGCAAAGATATGTATGTGAAAATATTTCA
ACAAATACAGAACCCAAAATCTCACATGTACAATGAGGTCATTGAAGATTGAAACTATCATCAAATTAAAATCTTGAACTGTAATTGATA
AGCTAAAGGTAAAAGCAAACTCCTCTTATTTATTTTACCTTTTAGAAAAACATCAGTTGCAGCAGAAACAGTGTTGGCAGCTCCAGCAGA
AATATGGTGATGGTGTAAAGGTAAAAGCACCTGAAAATCTGAAGCTACTTTAGATACCTTTTCATCTGTAACTCTGTTTTTTTCTGCAAA
GA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1509679.4e-4082 (15.1% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40078)
Chromosome
3
Position
166.20 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8842)
Chromosome
3
Position
125.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG533 was used as an overgo probe on plate 2 [well A4]

Plausible BAC Matches:   P046N24,   P067J14,   P204A17,   P291K24,   P051F23,   P204B17,   P043F09,   P293B19,   P271B07

 Overgo Sequences

A sequence
GTGTGTTCCAGCAGTTGAGACATA
B sequence
GTAGCAAGTTAGTCCGTATGTCTC
AB sequence
GTGTGTTCCAGCAGTTGAGACATACGGACT
Marker sequence
TTGTTCTTGATGTTTTTTTAGTAGTATGACGGGTGTAAAGATTACTTATG
TAGTTCATATATATATAAATAAAAAAGTTTGACAACTTCAAAATTTTGGA
TGCAAGTTCTTAGTATTGATATGCAAAAAAAATTATGATGAAAACTAATA
ATAGGTAATTTGGTAAAACTGATGCAGTTTACGTAGTGTACTCAGTATTC
AAGATTATTTTATTAAAATAAAAATTGCTGTAAAAAACAATCATATACAT
ATATAGAGTAAAACAAAAAGTTAATAATTAAATTATTTTTGATAAAATAA
AGGTCATTATTTTTAACATGCTAACAATAAAAAGTGTGTTCCAGCAGTTG
AGACATACGGACTAACTTGCTACATTATTATTATATTATTAATAGGTTGC
TAGGAAATTGTTTACGTAAAAATTAAATACCGTATATATATCGTATAAAT
ATATTATAATTGATAGTTGATTAGTAGATAAATTGTTCATATATATTGTG
TTTG
Genomic location of TG533  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D303 marker 303
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)