SGN Marker cLET-5-F17

SGN-M3047

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C87627
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51092)
Chromosome
3
Position
62.91 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49028)
Chromosome
3
Position
117.01 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40399)
Chromosome
3
Position
153.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-5-F17 was used as an overgo probe on plate 2 [well A3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATTCGTAGCCGTTTCGATTTCCGC
B sequence
ACCACCGGAGATGTTAGCGGAAAT
AB sequence
ATTCGTAGCCGTTTCGATTTCCGCTAACAT
Marker sequence
TTTCTCTCTAAGGATCTATTATTAGTAGTGAATTAAATTATTATTTTTGT
AGTAAAAATGGCTGGCGGCGTAGCTATTGGAAGTTTTAGTGATTCATTCA
GCGTTGTCTCTCTTAAGTCCTATCTTGCCGAATTCATCTCCACACTCATC
TTTGTCTTCGCCGGAGTTGGTTCCGCCATTGCTTACGGCAAGTTGACAAC
AAATGCTGCACTTGATCCGGCTGGGCTTGTAGCTATTGCAGTTTGCCATG
GATTTGCTCTATTCGTAGCCGTTTCGATTTCCGCTAACATCTCCGGTGGT
CATGTTAACCCTGCGGTCACCTGTGGATTAACCTTCGGCGGACATATTAC
CTTTATCACTGGCTCCTTCTACATGCTTGCTCAACTTACCGGCGCCGCTG
TAGCTTGCTTCCTCCTCAAATTCGTCACCGGAGGATGTGCTATTCCAACC
CATGGAGTGGGAGCTGGTGTGAGCATACTAGAAGGACTCGTGATGGAAAT
AATAATCACATTTGGTTTAGTTTATA
Genomic location of cLET-5-F17  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3047 marker 3047
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)