SGN Marker C2_At1g02140

SGN-M3864
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle299673 (SGN)
121932 (CGN)
---
Capsicum annuumSingleSGN-U204098---
Lycopersicon CombinedSingleSGN-U237263---
Solanum tuberosumMultipleSGN-U243161---
ArabidopsisSingleAt1g02140 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41283)
Chromosome
2
Position
11.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43259
Forward primer (5'-3')
TCCGTTATGCTAACAATTCCAAC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGTGTTCATTTCCCATCACAATCTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38048)
Chromosome
3
Position
71.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39353
Forward primer (5'-3')
TCCGTTATGCTAACAATTCCAAC
Accessions and product sizes
Solanum lycopersicum TA209
1500
Solanum pennellii TA56
1500
Approximate temperature
50°C
Reverse primer (5'-3')
TGTGTTCATTTCCCATCACAATCTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
600
Solanum lycopersicum TA209
700
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 24869)
Chromosome
1
Position
0.40 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 9871
Forward primer (5'-3')
TCCGTTATGCTAACAATTCCAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGTTCATTTCCCATCACAATCTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1500
Approximate temperature
50°C
  
PCR data   Exp. ID 9872
Forward primer (5'-3')
TCCGTTATGCTAACAATTCCAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGTTCATTTCCCATCACAATCTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1500
Approximate temperature
50°C
  
PCR data   Exp. ID 9873
Forward primer (5'-3')
TCCGTTATGCTAACAATTCCAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGTTCATTTCCCATCACAATCTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1550
Approximate temperature
50°C
  
PCR data   Exp. ID 12351
Forward primer (5'-3')
TCCGTTATGCTAACAATTCCAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGTTCATTTCCCATCACAATCTC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 12352
Forward primer (5'-3')
TCCGTTATGCTAACAATTCCAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGTTCATTTCCCATCACAATCTC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1500+1900
Approximate temperature
55°C
  
PCR data   Exp. ID 12353
Forward primer (5'-3')
TCCGTTATGCTAACAATTCCAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGTTCATTTCCCATCACAATCTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 320+1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12354
Forward primer (5'-3')
TCCGTTATGCTAACAATTCCAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGTTCATTTCCCATCACAATCTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 320+1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12355
Forward primer (5'-3')
TCCGTTATGCTAACAATTCCAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGTTCATTTCCCATCACAATCTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 320+1100
Approximate temperature
55°C
  
PCR data   Exp. ID 12356
Forward primer (5'-3')
TCCGTTATGCTAACAATTCCAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGTTCATTTCCCATCACAATCTC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 320+1100
Approximate temperature
55°C
  
PCR data   Exp. ID 12357
Forward primer (5'-3')
TCCGTTATGCTAACAATTCCAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGTTCATTTCCCATCACAATCTC
Enzymes
  
Accessions and product sizes
Physalis TA1367: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12358
Forward primer (5'-3')
TCCGTTATGCTAACAATTCCAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGTTCATTTCCCATCACAATCTC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 32588
Forward primer (5'-3')
TCCGTTATGCTAACAATTCCAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGTTCATTTCCCATCACAATCTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 32662
Forward primer (5'-3')
TCCGTTATGCTAACAATTCCAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGTTCATTTCCCATCACAATCTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 32663
Forward primer (5'-3')
TCCGTTATGCTAACAATTCCAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGTTCATTTCCCATCACAATCTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 32664
Forward primer (5'-3')
TCCGTTATGCTAACAATTCCAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGTTCATTTCCCATCACAATCTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 320+1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32665
Forward primer (5'-3')
TCCGTTATGCTAACAATTCCAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGTTCATTTCCCATCACAATCTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 320+1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32666
Forward primer (5'-3')
TCCGTTATGCTAACAATTCCAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGTTCATTTCCCATCACAATCTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 320+1100
Approximate temperature
55°C
  
PCR data   Exp. ID 9874
Forward primer (5'-3')
TCCGTTATGCTAACAATTCCAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGTTCATTTCCCATCACAATCTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference, AluI, MspI
All possible enzymes for lycopersicum and pimpinellifolium: amplicon difference, AluI, HinfI
  
Accessions and product sizes
Solanum pennellii LA716: 1500
Solanum lycopersicum LA925: 1500
Approximate temperature
50°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At1g02140 was used as an overgo probe on plate 13 [well E2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGTAAATTCGGGCATGAGTTCTTG
B sequence
GCCTAAACTCGAACTCCAAGAACT
AB sequence
GGTAAATTCGGGCATGAGTTCTTGGAGTTC
Marker sequence
ATGGCGGAGACAGGGGACGAAAATGCAGGGGAGTTTTACTTGAGGTACTA
TGTCGGCCACAAGGGTAAATTCGGGCATGAGTTCTTGGAGTTCGAGTTTA
GGCCCGACGGCAAGCTGCGGTATGCTAATAATTCCAACTATAAGAACGAC
ACCATGATCCGTAAAGAGGTCTTCGTCACCCCCGCCGTTCTAAAAGAATG
CCGTCGCATCGTCGTTGAAAGCGAGNNNNNATAATGAAGGAAGATGACAA
CAATTGGCCAGAACCAGATCGCGTTGGAAGGCAAGAGCTGGAGATTGTAA
TGGGGAACGAGCACATATCTTTTACCACTGCTAAGATTGGTTCTCTCGTG
GATGTTAATATCAGTAAAGATCCTGAAGGTCTTCGAATCTTCTATTATCT
TGTTCAGNNNNNGATTTGAAGTGTTTCGTGTTTTCTCTTATCTCACTCCA
CTTCAAGATCAAACCCATTTGA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At1g02140  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3864 marker 3864
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)