SGN Marker TG132

SGN-M394

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1000
Vector
pUC
Cutting Site
SRD/PST1
Drug Resistance
AMP
Image
Forward sequence
CCATCTTTGACAATAAATGTAGGTTCCTTAGGTAGAGGCAGATCCGTCTCACTGTTTACCATAAGAACAACAGACGGCATTGATGGCCTA
TCAACAGCATGATCCTGGACACAAAGCAGGCCAATATGTATGCATCTCAGAACTGTTGCAGAGGAACTTGAGTCCAAAATTGATTTATCC
ATTAAGTCTAACTCTTTGCTTTCGGTCTGTAGCTTCCATGCCTGAAATCATTTATACTGTAAGTTTGTGAGAATAACTAGTGGCAAGATA
TCCTGCTGATTTTTCACTTACATAACTGACAAGGTTGAGATGATTTTCATGGTCATAAAATCCGCTGTTTTTCTTTCCACTGACAATCTC
TAGTAGCAATACGGCGAAGCTGTAGACATCAGATTTTTCAGAAAATAGTCCTCCCATTGCATACTCTGGTGACATATAACCGCTGCAAGA
ACGTGTTAGTATTTTCGATTATGATGAACTTGTTTGACGATAGAAAATGCACTAACTTTGAA
Reverse sequence
not available
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1647691.5e-0780 (15.6% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53513)
Chromosome
3
Position
4.98 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Pepper-COSII   
Map version
58 (location: 41625)
Chromosome
4
Position
36.40 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43592
Forward primer (5'-3')
GGTAGAGGCAGATCCGTCTCACT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTGGCGTATTGCTGCTAGAGATTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-AC99   
Map version
34 (location: 9055)
Chromosome
4
Position
17.28 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Pepper-FAO3   
Map version
31 (location: 9054)
Chromosome
4
Position
103.64 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-FAO3

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9053)
Chromosome
3
Position
27.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 9056)
Chromosome
3
Position
0.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG132 was used as an overgo probe on plate 2 [well H5]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CAACAGACGGCATTGATGGCCTAT
B sequence
CAGGATCATGCTGTTGATAGGCCA
AB sequence
CAACAGACGGCATTGATGGCCTATCAACAG
Marker sequence
CCATCTTTGACAATAAATGTAGGTTCCTTAGGTAGAGGCAGATCCGTCTC
ACTGTTTACCATAAGAACAACAGACGGCATTGATGGCCTATCAACAGCAT
GATCCTGGACACAAAGCAGGCCAATATGTATGCATCTCAGAACTGTTGCA
GAGGAACTTGAGTCCAAAATTGATTTATCCATTAAGTCTAACTCTTTGCT
TTCGGTCTGTAGCTTCCATGCCTGAAATCATTTATACTGTAAGTTTGTGA
GAATAACTAGTGGCAAGATATCCTGCTGATTTTTCACTTACATAACTGAC
AAGGTTGAGATGATTTTCATGGTCATAAAATCCGCTGTTTTTCTTTCCAC
TGACAATCTCTAGTAGCAATACGGCGAAGCTGTAGACATCAGATTTTTCA
GAAAATAGTCCTCCCATTGCATACTCTGGTGACATATAACCGCTGCAAGA
ACGTGTTAGTATTTTCGATTATGATGAACTTGTTTGACGATAGAAAATGC
ACTAACTTTGAA
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG132  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D394 marker 394
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)