SGN Marker CT64

SGN-M448

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
800
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT64 image not available
Forward sequence
CGTTTGCAATTTTGGGGAAAATTTATTCCATTTTGCTCGATTTTTTTCTTCCATTTAATAATTTATTGTTTACTTGCAAAGAAGTAAAAA
AATTTCTTTGGATTTTTAGCCTAAGTCTTTCTCATTAAGTTGATATGCTTGTTTTAACATCTCCTGTTTTATGCTATTAGGGGAACTGTC
AGCAATATCAATTTGTAAGAAACATACAGCAATCCCATGGTGTTGGTGTGGGTACCAATAAATCACCTAAATCCCCCTGGATGCCTTTCT
CTATGTTATTCGGAGCTATTTCAGCTAAAGTGTCTCCAAAAGATTTGAAATTGGTTCATGCACATTATGACTTGTTCAGGAGCAAAAAAA
TTTCCCGGAATGATTTCATTAGAAGGCTGAGGTTGATAGTGGGTGATCAGTTATTGAAGTCTACCATAACCAATCTCCAGTGTAAGGTAC
TGTGCTCCGATCCATATATGATTTGGTAGTTTTGTACTTCCGATGGGGTG
Reverse sequence
TTTTTTTTTTTTTTTTTTTTTTTTGACTATATAGGGACAACAGTAAGGGCTCAATACACTTTAAACTAAAGGAGAAATTCTTGGACCAAA
AAGGAAATATAAAATAAAAGGATACATATGCCACCTAAACTTATTGAAAAAAACTTGCCACCCAAACTAAAGAGTAAACCAACTTTTTTT
CCTACTTCGCTTAAACCAAAATTAATATATCAATTCGAGACAAGTGCAGTTGTCAACAAACACCCCATCGGAAGTACAAAACTACCAAAT
CATATATGGATCGGAGCACAGTACCTTACACTGGAAATTGGTTATGGTAAACTTCAATAACTGATCACCCACTATCAACCTCAGCCTTCT
AATGAAATCATTCCGGGAAATTTTTTTGCTCCTGAACAAGTCATAATGTGCATGAACCAATTTCAAATCTTTTGGAGACACTTTAGCTGA
AATAGCTCCGAATAACATAGAGAAAGGCATCCAGGGGGATTTAGGTGATTTATTG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1452161e-143277 (55.4% of RFLP seq)+
SGN-U1452161.8e-99211 (41.8% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 51901)
Chromosome
8
Position
85.47 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_8 MQTL_1_Maturity_8 MQTL_2_Late_blight_8
Potato meta-QTL consensus map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39063)
Chromosome
8
Position
49.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9196)
Chromosome
8
Position
48.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT64 was used as an overgo probe on plate 1 [well D5]

Plausible BAC Matches:   P003P22,   P002L24,   P309C23,   P209E19,   P106E03,   P047J02,   P320P23

 Overgo Sequences

A sequence
CCCGGAATGATTTCATTAGAAGGC
B sequence
CCCACTATCAACCTCAGCCTTCTA
AB sequence
CCCGGAATGATTTCATTAGAAGGCTGAGGT
Marker sequence
CGTTTGCAATTTTGGGGAAAATTTATTCCATTTTGCTCGATTTTTTTCTT
CCATTTAATAATTTATTGTTTACTTGCAAAGAAGTAAAAAAATTTCTTTG
GATTTTTAGCCTAAGTCTTTCTCATTAAGTTGATATGCTTGTTTTAACAT
CTCCTGTTTTATGCTATTAGGGGAACTGTCAGCAATATCAATTTGTAAGA
AACATACAGCAATCCCATGGTGTTGGTGTGGGTACCAATAAATCACCTAA
ATCCCCCTGGATGCCTTTCTCTATGTTATTCGGAGCTATTTCAGCTAAAG
TGTCTCCAAAAGATTTGAAATTGGTTCATGCACATTATGACTTGTTCAGG
AGCAAAAAAATTTCCCGGAATGATTTCATTAGAAGGCTGAGGTTGATAGT
GGGTGATCAGTTATTGAAGTCTACCATAACCAATCTCCAGTGTAAGGTAC
TGTGCTCCGATCCATATATGATTTGGTAGTTTTGTACTTCCGATGGGGTG
Genomic location of CT64  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D448 marker 448
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)