SGN Marker TG159

SGN-M459

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2050
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CTCGGGTTGGCTGGGAAAATTAACCCTCTTGACCACTCGGCCAAGGGTCACACTTGTGTTAAGTGGGGTCAGAATTTAATAAATACATAT
ATATTTTTTTAAAACTGATTAAATATGCATATATATACGATGCTATTTTTCAACGAAGTGGGTTCATATATATATATGAACCCATTTGAC
CCACTGTAGGTCTGCCCCTGCCGATTCCCATCAACTTCTTCCCCAACTCCTGAATTTAATTATAAGTCAAGCCCCCAGCTTAATCCTTGG
TTGGTCAGACAACCCTCTTTTCCCTCTTTTAATCACTAGATCCATTACTGAGAGCTTGCGTTGCGTTGGGTTGTAAGGCTCTCACTCGGG
ATAGCCTTACAATCCTTGCTTAACCT
Reverse sequence
not available
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39917)
Chromosome
1
Position
165.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9216)
Chromosome
1
Position
133.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG159 was used as an overgo probe on plate 3 [well A6]

Plausible BAC Matches:   P251C02,   P068G02,   P119I16,   P052O01

 Overgo Sequences

A sequence
CCAGCTTAATCCTTGGTTGGTCAG
B sequence
GGGAAAAGAGGGTTGTCTGACCAA
AB sequence
CCAGCTTAATCCTTGGTTGGTCAGACAACC
Marker sequence
CTCGGGTTGGCTGGGAAAATTAACCCTCTTGACCACTCGGCCAAGGGTCA
CACTTGTGTTAAGTGGGGTCAGAATTTAATAAATACATATATATTTTTTT
AAAACTGATTAAATATGCATATATATACGATGCTATTTTTCAACGAAGTG
GGTTCATATATATATATGAACCCATTTGACCCACTGTAGGTCTGCCCCTG
CCGATTCCCATCAACTTCTTCCCCAACTCCTGAATTTAATTATAAGTCAA
GCCCCCAGCTTAATCCTTGGTTGGTCAGACAACCCTCTTTTCCCTCTTTT
AATCACTAGATCCATTACTGAGAGCTTGCGTTGCGTTGGGTTGTAAGGCT
CTCACTCGGGATAGCCTTACAATCCTTGCTTAACCT
Genomic location of TG159  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D459 marker 459
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)