SGN Marker CT59

SGN-M46

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1100
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT59 image not available
Forward sequence
CTTTTTTTTTTTTTTTTGGTCTATATTTTCTTTTAGCTACCATGGATAGAAAATTTGTATTTCTAGTATCAATTTTGTGCATTGTAGTGG
CAAGTGTCACGGGTCAGACACCTGCCGCAGCACCCGTTGGTGCTAAGGCTGGTACTACTCCACCAGCTGCTGCACCAACTAAGCCGAAAA
CTCCTGCTCCCGCAACAGCACCAGCCTCGGCCCCACCTACAGCTGTTCCTGTTGCTCCAGTAACCGCTCCAGTTACTGCTCCCACTACAC
CTGTTGTTGCTGCACCCGTATCAGCACCAGCAAGTTCTCCACCACTTAAAGCACCAGCAAGTTCTCCACCAGTACAATCTCCACCAGCTC
CAGCTCCAGAGGTAGCTACACCGCCAGCTGTTTCTACTCCACCGGCTGCAGCTCCAGTTGCTGCACCTGTTGCTTCGGAGACAACTCCAG
CTCCGGCTCCTAGCAAAGGAAAAGTAAAGGGAAAGAAGGGAAAGAAACACAATGCATCACCAG
Reverse sequence
CTTTTTTTTTTTTTTTTGGTCTATATTTTCTTTTAGCTACCATGGATAGAAAATTTGTATTTCTAGTATCAATTTTGTGCATTGTAGTGG
CAAGTGTCACGGGTCAGACACCTGCCGCAGCACCCGTTGGTGCTAAGGCTGGTACTACTCCACCAGCTGCTGCACCAACTAAGCCGAAAA
CTCCTGCTCCCGCAACAGCACCAGCCTCGGCCCCACCTACAGCTGTTCCTGTTGCTCCAGTAACCGCTCCAGTTACTGCTCCCACTACAC
CTGTTGTTGCTGCACCCGTATCAGCACCAGCAAGTTCTCCACCACTTAAAGCACCAGCAAGTTCTCCACCAGTACAATCTCCACCAGCTC
CAGCTCCAGAGGTAGCTACACCGCCAGCTGTTTCTACTCCACCGGCTGCAGCTCCAGTTGCTGCACCTGTTGCTTCGGAGACAACTCCAG
CTCCGGCTCCTAGCAAAGGAAAAGTAAAGGGAAAGAAGGGAAAGAAACACAATGCATCACCAGCACCTTCTCCCGA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U146725496 (96.7% of RFLP seq)+
SGN-U146725509 (96.8% of RFLP seq)-
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42354)
Chromosome
2
Position
89.30 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39060)
Chromosome
2
Position
137.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

Map: Pepper-FAO3   
Map version
31 (location: 7861)
Chromosome
2
Position
33.09 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-FAO3

Map: Eggplant-LXM 2002   
Map version
29 (location: 7859)
Chromosome
2
Position
82.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7858)
Chromosome
2
Position
116.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Other PCR data 
PCR data   Exp. ID 35569
Forward primer (5'-3')
CACCAACTAAGCCGAAAACTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GTGCAGGTGGGCTCATCAT
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 425
Solanum lycopersicum LA925: 400
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
CT59 was used as an overgo probe on plate 6 [well B10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TATCAGCACCAGCAAGTTCTCCAC
B sequence
GCTGGTGCTTTAAGTGGTGGAGAA
AB sequence
TATCAGCACCAGCAAGTTCTCCACCACTTA
Marker sequence
CTTTTTTTTTTTTTTTTGGTCTATATTTTCTTTTAGCTACCATGGATAGA
AAATTTGTATTTCTAGTATCAATTTTGTGCATTGTAGTGGCAAGTGTCAC
GGGTCAGACACCTGCCGCAGCACCCGTTGGTGCTAAGGCTGGTACTACTC
CACCAGCTGCTGCACCAACTAAGCCGAAAACTCCTGCTCCCGCAACAGCA
CCAGCCTCGGCCCCACCTACAGCTGTTCCTGTTGCTCCAGTAACCGCTCC
AGTTACTGCTCCCACTACACCTGTTGTTGCTGCACCCGTATCAGCACCAG
CAAGTTCTCCACCACTTAAAGCACCAGCAAGTTCTCCACCAGTACAATCT
CCACCAGCTCCAGCTCCAGAGGTAGCTACACCGCCAGCTGTTTCTACTCC
ACCGGCTGCAGCTCCAGTTGCTGCACCTGTTGCTTCGGAGACAACTCCAG
CTCCGGCTCCTAGCAAAGGAAAAGTAAAGGGAAAGAAGGGAAAGAAACAC
AATGCATCACCAG
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of CT59  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D46 marker 46
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)