SGN Marker TG71

SGN-M463

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2200
Vector
pUC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
TG71 image not available
Forward sequence
ACGCTTTATTATTATACTCGCTCCGTTTCCGTTTCATATTATTTGATTTTGTTCTAAAATCAAGAATAAAAAGAAAACACATTTGTTGGA
TTATTCTTAAAAAAAAATAAATACTGAAATTTTCCTTGTACTTTAAAAAAGAAAATTGATTCTATCTTAATTTAATAAATAATTTGATAT
AATTATTTATATCAAATTATAAGACTAATATGGAACGACGAAAATAAAACTTTTACTTAGAAAAGACATTGGTTATTTTTGCAGTGGTTA
TCATTATTCATAGGCCACAACATTTTAGTAAGAAATTTGAATAAAATAGTAAAGGAGTTACCTCAGTCTCAAAATAAATATTACTGCAAA
TAAAATTTGTTCCAAAATAAGTATTGCATTAGAAAGATAAAAATCATTTTTTATATTAAGAAATTACTTTTTCTTAATAGCGCTCATTCA
AAAATATCTAATAAATAAGATAAATAAATGATATCTTATATA
Reverse sequence
ACGCTTTATTATTATACTCGCTCCGTTTCCGTTTCATATTATTTGATTTTGTTCTAAAATCAAGAATAAAAAGAAAACACATTTGTTGGA
TTATTCTTAAAAAAAAATAAATACTGAAATTTTCCTTGTACTTTAAAAAAGAAAATTGATTCTATCTTAATTTAATAAATAATTTGATAT
AATTATTTATATCAAATTATAAGACTAATATGGAACGACGAAAATAAAACTTTTACTTAGAAAAGACATTGGTTATTTTTGCAGTGGTTA
TCATTATTCATAGGCCACAACATTTTAGTAAGAAATTTGAATAAAATAGTAAAGGAGTTACCTCAGTCTCAAAATAAATATTACTGCAAA
TAAAATTTGTTCCAAAATAAGTATTGCATTAGAAAGATAAAAATCATTTTTTATATTAAGAAATTACTTTTTCTTAATAGCGCTCATTCA
AAAATATCTAATAAATAAGATAAATAAATGATATCTTATA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53379)
Chromosome
1
Position
72.16 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_1 MQTL_2_Late_blight_1
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9223)
Chromosome
1
Position
58.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9224)
Chromosome
1
Position
33.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG71 was used as an overgo probe on plate 14 [well C5]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P305L17,   P312D06,   P236K17,   P172B01,   P327L17,   P264H21,   P005A03,   P090G19,   P075J08,   P305K18,   P305L18,   P266O01,   P068O18,   P305M18,   P003G19,   P280D08

 Overgo Sequences

A sequence
TTGGTTATTTTTGCAGTGGTTATC
B sequence
GTGGCCTATGAATAATGATAACCA
AB sequence
TTGGTTATTTTTGCAGTGGTTATCATTATT
Marker sequence
ACGCTTTATTATTATACTCGCTCCGTTTCCGTTTCATATTATTTGATTTT
GTTCTAAAATCAAGAATAAAAAGAAAACACATTTGTTGGATTATTCTTAA
AAAAAAATAAATACTGAAATTTTCCTTGTACTTTAAAAAAGAAAATTGAT
TCTATCTTAATTTAATAAATAATTTGATATAATTATTTATATCAAATTAT
AAGACTAATATGGAACGACGAAAATAAAACTTTTACTTAGAAAAGACATT
GGTTATTTTTGCAGTGGTTATCATTATTCATAGGCCACAACATTTTAGTA
AGAAATTTGAATAAAATAGTAAAGGAGTTACCTCAGTCTCAAAATAAATA
TTACTGCAAATAAAATTTGTTCCAAAATAAGTATTGCATTAGAAAGATAA
AAATCATTTTTTATATTAAGAAATTACTTTTTCTTAATAGCGCTCATTCA
AAAATATCTAATAAATAAGATAAATAAATGATATCTTATATA
Genomic location of TG71  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D463 marker 463
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)