SGN Marker C2_At5g06370
SGN-M4653
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species
| Synonyms |
| Locus associations |
| Orthologs in this COSII group |
| Species | Copies | Sequence ID | CDS/Edited sequence | Peptide sequence | Predicted introns |
|---|---|---|---|---|---|
| Coffee | Single | 311781 (SGN) 128066 (CGN) | - | - | - |
| Capsicum annuum | Single | SGN-U197669 | - | - | - |
| Lycopersicon Combined | Multiple | SGN-U215776 | - | - | - |
| Solanum tuberosum | Single | SGN-U247134 | - | - | - |
| Arabidopsis | Single | At5g06370 on TAIR | - | - | - |
Mapped locations
|
| ![]() Tomato-EXPEN 2000 |
| ||||||||||||||||||
| ![]() Arabidopsis COSII |
| Other PCR data |
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| Unigene blast matches for primers |
| Overgo hybridization and physical mapping |
C2_At5g06370 was used as an overgo probe on plate 13 [well C1]
Plausible BAC Matches: P111H14, P206I22, P130I12, P012N11, P267K08, P317K04
Overgo Sequences
|
A sequence
CACAAGACGTGGTCAAGAAGTAGG
|
|
B sequence
CAGAATGGTTCCAGTTCCTACTTC
|
|
AB sequence
CACAAGACGTGGTCAAGAAGTAGGAACTGG
|
|
Marker sequence
ATGGGGTTGCTTTCTAATAGNNNNNAATTGATAGAAGCAGCCTCAAACCT
GGAGATCATATTTATTCTTGGCGTACTGCTTATATTTATGCCCATCATGN NNNNGTATCTATGTTGGGGATAATAAAGTCATTCACTTCACAAGACGTGG TCAAGAAGTAGGAACTGGAACCATTCTGGATCAT |
| Universal primers for Asterid species |
No additional PCR data found.
| Other COSII sequence data |
BLASTX result of original unigene sequences against Arabidopsis protein database
Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree | [View]
BLASTX result of original unigene sequences against Arabidopsis protein database
Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree | [View]
Related Markers
|
Related Genotyped Markers: These markers have been genotyped and share a name with this marker
Genomic location of C2_At5g06370
|
| User comments |
Please wait, checking for comments. (If comments do not show up, access them here)
Mapped locations
Mapped locations


