SGN Marker TG72

SGN-M466

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2900
Vector
pUC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
TG72 image not available
Forward sequence
GTGAAGAATGAACAAACTAGTATATTTCGCATCAAAAAAGTCCCATAATACTTCCTCACATTGATATTTTTTAGAATAAAAGATCACTTA
CTACTCCGCCACGAAATCGTCATACTCAATAAGGTATGTGGGTCCACAATAGATAGCTTGCCACAACAATAACAAATTGGAATCTTGTAA
TCAGGACACGTAACCTTCTATACAGTTCTGATCGAACGGCTCATATTCTGCCACTTGACCCCCTACTTTTTTCCATTTTTATTCACTTTT
TTTTTTCCTTCTCAAATCTAGGACAAATAATCCATTGTTTCTCTCTCTTTGGTTTCCACTTTATTAGTTTTTTCTCCAAAAAGCCCCTTC
CCCAAATCTCAGATCTATACAAACACAAAGGTTATTTCAGTAATTATCCTCTTTACCCATAGTGTTTTTATTTATTTATTTATTTTTAGC
AGTTAGACAAAAAGGAAGAAACAATTTTTTTTTTTTGTTTT
Reverse sequence
GTGAAGAATGAACAAACTAGTATATTTCGCATCAAAAAAGTCCCATAATACTTCCTCACATTGATATTTTTTAGAATAAAAGATCACTTA
CTACTCCGCCACGAAATCGTCATACTCAATAAGGTATGTGGGTCCACAATAGATAGCTTGCCACAACAATAACAAATTGGAATCTTGTAA
TCAGGACACGTAACCTTCTATACAGTTCTGATCGAACGGCTCATATTCTGCCACTTGACCCCCTACTTTTTTCCATTTTTATTCACTTTT
TTTTTTCCTTCTCAAATCTAGGACAAATAATCCATTGTTTCTCTCTCTTTGGTTTCCACTTTATTAGTTTTTTCTCCAAAAAGCCCCTTC
CCCAAATCTCAGATCTATACAAACACAAAGGTTATTTCAGTAATTATCCTCTTTACCCATAGTGTTTTTATTTATTTATTTATTTTTAGC
AGTTAGACAAAAAGGAAGAAACAATTTTTTTTTTTTGTTTT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53380)
Chromosome
8
Position
80.54 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_8 MQTL_1_Maturity_8 MQTL_2_Late_blight_8
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9226)
Chromosome
8
Position
22.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9227)
Chromosome
8
Position
9.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Genomic location of TG72  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D466 marker 466
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)