SGN Marker C2_At5g35360

SGN-M4661
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Lycopersicon CombinedSingleSGN-U230893---
Solanum tuberosumSingleSGN-U251070---
ArabidopsisSingleAt5g35360 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38841)
Chromosome
1
Position
21.30 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39956
Forward primer (5'-3')
AACAGATCCGTGTCGCTATGGGAG
Accessions and product sizes
Solanum pennellii TA56
100
Solanum lycopersicum TA209
150
Approximate temperature
53°C
Reverse primer (5'-3')
TTGAATGTCCTCTAAGCACAATATCCTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27339)
Chromosome
5
Position
13.60 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11850
Forward primer (5'-3')
AACAGATCCGTGTCGCTATGGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAATGTCCTCTAAGCACAATATCCTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 11851
Forward primer (5'-3')
AACAGATCCGTGTCGCTATGGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAATGTCCTCTAAGCACAATATCCTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 11852
Forward primer (5'-3')
AACAGATCCGTGTCGCTATGGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAATGTCCTCTAAGCACAATATCCTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 13838
Forward primer (5'-3')
AACAGATCCGTGTCGCTATGGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAATGTCCTCTAAGCACAATATCCTC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13839
Forward primer (5'-3')
AACAGATCCGTGTCGCTATGGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAATGTCCTCTAAGCACAATATCCTC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13840
Forward primer (5'-3')
AACAGATCCGTGTCGCTATGGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAATGTCCTCTAAGCACAATATCCTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13841
Forward primer (5'-3')
AACAGATCCGTGTCGCTATGGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAATGTCCTCTAAGCACAATATCCTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13842
Forward primer (5'-3')
AACAGATCCGTGTCGCTATGGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAATGTCCTCTAAGCACAATATCCTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13843
Forward primer (5'-3')
AACAGATCCGTGTCGCTATGGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAATGTCCTCTAAGCACAATATCCTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13844
Forward primer (5'-3')
AACAGATCCGTGTCGCTATGGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAATGTCCTCTAAGCACAATATCCTC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13845
Forward primer (5'-3')
AACAGATCCGTGTCGCTATGGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAATGTCCTCTAAGCACAATATCCTC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13846
Forward primer (5'-3')
AACAGATCCGTGTCGCTATGGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAATGTCCTCTAAGCACAATATCCTC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 33253
Forward primer (5'-3')
AACAGATCCGTGTCGCTATGGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAATGTCCTCTAAGCACAATATCCTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 33254
Forward primer (5'-3')
AACAGATCCGTGTCGCTATGGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAATGTCCTCTAAGCACAATATCCTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 33255
Forward primer (5'-3')
AACAGATCCGTGTCGCTATGGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAATGTCCTCTAAGCACAATATCCTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 33256
Forward primer (5'-3')
AACAGATCCGTGTCGCTATGGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAATGTCCTCTAAGCACAATATCCTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 11853
Forward primer (5'-3')
AACAGATCCGTGTCGCTATGGGAG
Digested band sizes (using amplicon difference)
Solanum pennellii LA716: 500
Solanum lycopersicum LA925: 450
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAATGTCCTCTAAGCACAATATCCTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
All possible enzymes for lycopersicum and pimpinellifolium: AluI,MspI,RsaI,DraI,TaqI,RV,HaeIII,HinfI,DpnII,KpnI
  
Accessions and product sizes
Solanum lycopersicum LA925: 450
Solanum pennellii LA716: 500
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
C2_At5g35360 was used as an overgo probe on plate 13 [well D2]

Plausible BAC Matches:   P211B23,   P305J13,   P244A10,   P162I22,   P308B14,   P236O08,   P296H04,   P198N17,   P105E12,   P271N11,   P030P13,   P076F15,   P253A12

 Overgo Sequences

A sequence
GAATGCTGGTGTTCCAACTGTACC
B sequence
TAGTCCGTCACTTCCTGGTACAGT
AB sequence
GAATGCTGGTGTTCCAACTGTACCAGGAAG
Marker sequence
NNNNNGTGACATGCCGCGCCGAGAAAATTCTGGTGGCAAATAGAGGAGAG
ATTGTTGTTCGCGTGATCCGAACTGCCCATGAGATGGGAATTCCTTGTGT
TGCGGTTTATTCGACCATTGATAAAGATGCCTTACATGTGAAGCTAGCTG
ATGAATCTGTTTGCATTGGAGAAGCACCAAGTAATCAGTCNNNNNGTATT
TAGTGATCCCAAATGTCTTGTCTGCTGCTATCAGTCGCGGATGTACAATG
TTGCATCCTGGATATGGTTTCCTTTCTGAGAATGCAAGTTTTGTTGAGAT
GTGCAGAGAACATGGAATCAACTTTATTGGGCCAAATNNNNNCCAGACAG
CATAAGAGTCATGGGTGACAAAGCCACTGCTAGAGATACAATGAAGAATG
CTGGTGTTCCAACTGTACCAGGAAGTGACGGACTATTGCAGNNNNNAGTA
CTGAAGAAGGTGTAAAGCTTGCCGAGGAGATTGGTTACCCCGTGATGATT
AAGNNNNNGCAACAGCTGGTGGTGGTGGACGTGGAATGCGTCTTGCTAAA
GAACCTAATGAGTTCGTAAAATTATTGCAGNNNNNCAAGCTAAGAGTGAA
GCAGCAGCTGCATTTGGAAATGATGGCGTTTATCTGGAGAAGTACATCGT
AAATCCCAGGCACATTGAATTTCAGNNNNNGTTTTGGCGGACAAGTATGG
TAATGTTGTACACTTTGGAGAGCGTGATTGCAGTATTCAGNNNNNAGAAG
AAACCAAAAGTTGCTGGAGGAAGCACCATCCCCGGCATTGACACCAGAGC
TGAGGAAAGCCATGGGTGATGCAGCTGTGGCAGCAGCAGCATCTATAGGT
TACATTGGTGTTGGAACCATAGAGTTCCTATTGGATGAGAGAGGCTCCTT
TTACTTCATGGAAATGAACACTCGTATTCAGNNNNNGTAGAGCATCCGGT
GACAGAAATGATATCCTCTGTTGATCTGATAGAGGAACAGATCCGTGTCG
CTATGGGAGAAAAGCTCCCATACAAACAGNNNNNGAGGATATTGTGCTTA
GAGGACATTCAATTGAATGNNNNNNNNNNNNNNNNNNNNNNNNNN
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At5g35360  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4661 marker 4661
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)