SGN Marker C2_At4g30930

SGN-M4670
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U203042---
Lycopersicon CombinedSingleSGN-U217708---
Solanum tuberosumSingleSGN-U245365---
ArabidopsisSingleAt4g30930 on TAIR---
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132191)
Chromosome
2
Position
48.63 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38690)
Chromosome
2
Position
63.10 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39866
Forward primer (5'-3')
ATCATACCTTCTCTCTCCAAACCC
Accessions and product sizes
Solanum pennellii TA56
700
Solanum lycopersicum TA209
700
Approximate temperature
55°C
Reverse primer (5'-3')
TCGCCATTGCTCACTTTAAACTG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
220+340
Solanum pennellii TA56
220+380
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26855)
Chromosome
4
Position
15.05 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11525
Forward primer (5'-3')
ATCATACCTTCTCTCTCCAAACCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCCATTGCTCACTTTAAACTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 11526
Forward primer (5'-3')
ATCATACCTTCTCTCTCCAAACCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCCATTGCTCACTTTAAACTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 11527
Forward primer (5'-3')
ATCATACCTTCTCTCTCCAAACCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCCATTGCTCACTTTAAACTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 13486
Forward primer (5'-3')
ATCATACCTTCTCTCTCCAAACCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCCATTGCTCACTTTAAACTG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13487
Forward primer (5'-3')
ATCATACCTTCTCTCTCCAAACCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCCATTGCTCACTTTAAACTG
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 13488
Forward primer (5'-3')
ATCATACCTTCTCTCTCCAAACCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCCATTGCTCACTTTAAACTG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 680+850
Approximate temperature
55°C
  
PCR data   Exp. ID 13489
Forward primer (5'-3')
ATCATACCTTCTCTCTCCAAACCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCCATTGCTCACTTTAAACTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 13490
Forward primer (5'-3')
ATCATACCTTCTCTCTCCAAACCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCCATTGCTCACTTTAAACTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 580+750
Approximate temperature
55°C
  
PCR data   Exp. ID 13491
Forward primer (5'-3')
ATCATACCTTCTCTCTCCAAACCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCCATTGCTCACTTTAAACTG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 13492
Forward primer (5'-3')
ATCATACCTTCTCTCTCCAAACCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCCATTGCTCACTTTAAACTG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13493
Forward primer (5'-3')
ATCATACCTTCTCTCTCCAAACCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCCATTGCTCACTTTAAACTG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13494
Forward primer (5'-3')
ATCATACCTTCTCTCTCCAAACCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCCATTGCTCACTTTAAACTG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 420+750
Approximate temperature
55°C
  
PCR data   Exp. ID 13495
Forward primer (5'-3')
ATCATACCTTCTCTCTCCAAACCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCCATTGCTCACTTTAAACTG
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13496
Forward primer (5'-3')
ATCATACCTTCTCTCTCCAAACCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCCATTGCTCACTTTAAACTG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13497
Forward primer (5'-3')
ATCATACCTTCTCTCTCCAAACCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCCATTGCTCACTTTAAACTG
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 33118
Forward primer (5'-3')
ATCATACCTTCTCTCTCCAAACCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCCATTGCTCACTTTAAACTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 33119
Forward primer (5'-3')
ATCATACCTTCTCTCTCCAAACCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCCATTGCTCACTTTAAACTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 580+750
Approximate temperature
55°C
  
PCR data   Exp. ID 33120
Forward primer (5'-3')
ATCATACCTTCTCTCTCCAAACCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCCATTGCTCACTTTAAACTG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 33121
Forward primer (5'-3')
ATCATACCTTCTCTCTCCAAACCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCCATTGCTCACTTTAAACTG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 11528
Forward primer (5'-3')
ATCATACCTTCTCTCTCCAAACCC
Digested band sizes (using DpnII)
Solanum pennellii LA716: 220+380
Solanum lycopersicum LA925: 220+340
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCCATTGCTCACTTTAAACTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: RsaI, DpnII
  
Accessions and product sizes
Solanum lycopersicum LA925: 700
Solanum pennellii LA716: 700
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At4g30930 was used as an overgo probe on plate 13 [well E1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TATAAGGTGATCGGCCCACTTCAG
B sequence
AAACCCGGTCCGATTTCTGAAGTG
AB sequence
TATAAGGTGATCGGCCCACTTCAGAAATCG
Marker sequence
ATGGCAAATCGGCGATGCCTTCAAACCCTAACCCGTCATTTATCATACCT
TCTCTCTCCAAACCCGTCTCTTTGTTCCCCTCAAACCCTAACCCCACCAC
TGCTCAATTCCATCAACACACTAACTTCGTCTCCCAAATGCCCCCAAGTT
ACCACTCAACTTTCATCTTTCCACCGGCATTTCTCTTCGAATCGACCGAG
CAATAGCGACGAGGAGGAAGAGGATGAAAGTGAAGATGAAACAGATTATG
ATGATGACGATGATGATGACGTTGAGGGCTTCAAATCGAATAGTGAGCCC
GGTAGAGTATACACTCCGGAGGAGAAAGAGTACGAGGCGGCAGAAATTGG
ATATAAGGTGATCGGCCCACTTCAGAAATCGGACCGGGTTTTCAAACCAT
ATGAACCCGTTTATGCTGTTATTCAGNNNNNATTGGTTCCCACCAGTTTA
AAGTGAGCAATGGCGATTCCATTTTTGTGGAGAAACTGAAGTTCTGTGAA
GTCAATGACAAGNNNNNTTGATTCTAAACAAGGTTCTGCTGCTGGGCTCA
AAGACACAGACAATCATTGGCAGGCCTGTATTGCCTGATGCAGCTGTTCA
TGCTGTTGTTGAGGAGCATNNNNNGCATTAGATGCTAAAGTACTGATATT
CAAGAAGAAGAGACGAAAGAATTATCGACGAACACGAGGGCATCGACAGN
NNNNGAATTAACAAAGTTGAGGATTACGGATATTCAAGGAGTTGAAAAGC
CTGAAGTGGTACCAATTCTCAAGACAGAGAAGAAAGATGCTAAGAAGGTA
GCAGTAGCAGCTTAAAAATGGTGA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3 (2), plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At4g30930  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4670 marker 4670
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)