SGN Marker C2_At5g01990

SGN-M4676
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309442 (SGN)
127529 (CGN)
---
Capsicum annuumSingleSGN-U201301---
Lycopersicon CombinedMultipleSGN-U217820---
Solanum tuberosumSingleSGN-U254502---
ArabidopsisSingleAt5g01990 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41503)
Chromosome
10
Position
54.10 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43479
Forward primer (5'-3')
TATTGTTGGCCTTAGGAGGCAATC
Accessions and product sizes
Approximate temperature
63°C
Reverse primer (5'-3')
TGCAAACACAATCGCAACAGTTGTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38735)
Chromosome
10
Position
39.20 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39901
Forward primer (5'-3')
TATTGTTGGCCTTAGGAGGCAATC
Accessions and product sizes
Solanum lycopersicum TA209
250
Solanum pennellii TA56
250
Approximate temperature
55°C
Reverse primer (5'-3')
TGCAAACACAATCGCAACAGTTGTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
250
Solanum lycopersicum TA209
150
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26997)
Chromosome
5
Position
0.38 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11616
Forward primer (5'-3')
TATTGTTGGCCTTAGGAGGCAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAACACAATCGCAACAGTTGTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 11617
Forward primer (5'-3')
TATTGTTGGCCTTAGGAGGCAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAACACAATCGCAACAGTTGTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 11618
Forward primer (5'-3')
TATTGTTGGCCTTAGGAGGCAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAACACAATCGCAACAGTTGTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13604
Forward primer (5'-3')
TATTGTTGGCCTTAGGAGGCAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAACACAATCGCAACAGTTGTC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 280
Approximate temperature
55°C
  
PCR data   Exp. ID 13605
Forward primer (5'-3')
TATTGTTGGCCTTAGGAGGCAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAACACAATCGCAACAGTTGTC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13606
Forward primer (5'-3')
TATTGTTGGCCTTAGGAGGCAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAACACAATCGCAACAGTTGTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 280
Approximate temperature
55°C
  
PCR data   Exp. ID 13607
Forward primer (5'-3')
TATTGTTGGCCTTAGGAGGCAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAACACAATCGCAACAGTTGTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13608
Forward primer (5'-3')
TATTGTTGGCCTTAGGAGGCAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAACACAATCGCAACAGTTGTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13609
Forward primer (5'-3')
TATTGTTGGCCTTAGGAGGCAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAACACAATCGCAACAGTTGTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13610
Forward primer (5'-3')
TATTGTTGGCCTTAGGAGGCAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAACACAATCGCAACAGTTGTC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13611
Forward primer (5'-3')
TATTGTTGGCCTTAGGAGGCAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAACACAATCGCAACAGTTGTC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 280
Approximate temperature
55°C
  
PCR data   Exp. ID 13612
Forward primer (5'-3')
TATTGTTGGCCTTAGGAGGCAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAACACAATCGCAACAGTTGTC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13613
Forward primer (5'-3')
TATTGTTGGCCTTAGGAGGCAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAACACAATCGCAACAGTTGTC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 280
Approximate temperature
55°C
  
PCR data   Exp. ID 13614
Forward primer (5'-3')
TATTGTTGGCCTTAGGAGGCAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAACACAATCGCAACAGTTGTC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 33157
Forward primer (5'-3')
TATTGTTGGCCTTAGGAGGCAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAACACAATCGCAACAGTTGTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 280
Approximate temperature
55°C
  
PCR data   Exp. ID 33158
Forward primer (5'-3')
TATTGTTGGCCTTAGGAGGCAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAACACAATCGCAACAGTTGTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 33159
Forward primer (5'-3')
TATTGTTGGCCTTAGGAGGCAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAACACAATCGCAACAGTTGTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 33160
Forward primer (5'-3')
TATTGTTGGCCTTAGGAGGCAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAACACAATCGCAACAGTTGTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 11619
Forward primer (5'-3')
TATTGTTGGCCTTAGGAGGCAATC
Digested band sizes (using HaeIII)
Solanum lycopersicum LA925: 150
Solanum pennellii LA716: 250
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAACACAATCGCAACAGTTGTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: HaeIII
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Solanum pennellii LA716: 250
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At5g01990 was used as an overgo probe on plate 13 [well E10]

Plausible BAC Matches:   P228H03,   P029I24,   P214E02,   P236A04,   P156B03,   P109F07,   P104J06

 Overgo Sequences

A sequence
ACCGAGTCATCCATCAGGTAGTTC
B sequence
TGGAACTTGCTCTGCAGAACTACC
AB sequence
ACCGAGTCATCCATCAGGTAGTTCTGCAGA
Marker sequence
ATGGATAGGGTGTCGAGGATTCTTTTTAGTGTTCTGACAGAACCGCAACG
AGGAGGACAGTCTTTCATCACGTCGATTAAGATTGCTGTTTTACCGATTG
CGAAAGTGTTTACACTATGCTTCTTGGGATTTTTGATGGCCTCCAAGTAT
GTCAATATTCTTCCAGCAAATGGACGGAAGCTTTTAAATGGGNNNNNTTG
GTGTTTTCACTTTTGCTGCCATGCTTGATATTCTCTCAACTTGGACAAGC
CATTACGTATGAGAAATTGCTTCAGTGNNNNNGTGGTTCATCCCTGTTAA
CATTGTTTTGGCCACCATATTTGGTTCTATTATTGGTTTAATTGTTGCTA
CGATAGTCCGTCCGCCATACCCTTATTTCAAGTTTACCATTATACAGATT
GGCATTGNNNNNGGAACATAGGAAATGTTCCACTTGTTCTGATAGCTGCG
TTATGTCGTGACCCATCAAATCCTTTTGGTGACTCTGAGATATGTGCGCG
AGATGGAAATGCATACATCTCTTTTGGACAGTGGNNNNNGTTGGTGCAAT
TATCCTCTACACCTTTGTATTCCAAATGCTCTCACCTCCTCCTGAAGGTT
CCTTCGATGTTGAAGATGCAAACCTTCCTATCAAGGTTCCTAACAAAGAA
AGATTACCGAGTCATCCATCAGGTAGTTCTGCAGAGCAAGTTCCATTACT
TGCAACAAATGTTGCACCAGCCGACTCTAGTAGTTCAAATAAAGAAAAGN
NNNNGTTAAACAGTTCTTTAAATTTCTCTATGAGACACTGAAGCTCAAGC
AACTTATTCAACCTCCCATTATAGCTTCTNNNNNATCATAGCGATTATCA
TAGGATGTGTGCCGGTCCTGAAACGCCTCATCTTTACTTCTGATGCTCCA
CTTTACTTCTTCACTGACAGCTGTTTAATTCTTGGNNNNNGGATGCCATG
ATTCCCTGCATATTGTTGGCCTTAGGAGGCAATCTCGTTGACGNNNNNGG
CCAGGACCTGGAAGTTCAAAAATTGGTCTTAAGACAACTGTTGCGATTGT
GTTTGCACGGTTGTGTTTGGTTCCTCCAACTGGACTCAGTATTGTCATGT
TAGCTGATAAGCTTGGCTTCCTTCCTGCTGATGATAAAATGTTCAGATTC
GTTCTTCTTCTTCAGTATTCAATGCCCACATCCATACTTGCTGGTGCGGT
TGCCAACTTGAGAGGGTGTGGGAAGGAGGCAGCTTCAATCTTGTTTTGGG
TTCATATATTTGCTGTGATCTCTATN
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At5g01990  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4676 marker 4676
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)