SGN Marker C2_At5g42740

SGN-M4677
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle299909 (SGN)
123738 (CGN)
---
Capsicum annuumSingleSGN-U204994---
Lycopersicon CombinedSingleSGN-U214848---
Solanum tuberosumSingleSGN-U244929---
ArabidopsisSingleAt5g42740 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49300)
Chromosome
12
Position
5.27 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47240)
Chromosome
12
Position
54.60 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. acuminata   
Map version
89 (location: 46535)
Chromosome
9
Position
11.70 cM
Confidence
CF(LOD3)
Protocol
PCR


Tobacco N. acuminata

Map: Pepper Capsicum   
Map version
65 (location: 42691)
Chromosome
3
Position
86.40 cM
Confidence
uncalculated
Protocol
PCR


Pepper Capsicum

Map: Pepper-COSII   
Map version
58 (location: 41534)
Chromosome
3
Position
53.00 cM
Confidence
I(LOD2)
Protocol
PCR


Pepper-COSII

PCR data   Exp. ID 43510
Forward primer (5'-3')
AGCACCATTTGAGAAAAATATACCTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ATCCAAGGAATGAAACATTCCACAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38861)
Chromosome
12
Position
54.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39967
Forward primer (5'-3')
AGCACCATTTGAGAAAAATATACCTG
Accessions and product sizes
Solanum pennellii TA56
450
Solanum lycopersicum TA209
450
Approximate temperature
55°C
Reverse primer (5'-3')
ATCCAAGGAATGAAACATTCCACAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27403)
Chromosome
5
Position
17.16 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11901
Forward primer (5'-3')
AGCACCATTTGAGAAAAATATACCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCCAAGGAATGAAACATTCCACAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 11902
Forward primer (5'-3')
AGCACCATTTGAGAAAAATATACCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCCAAGGAATGAAACATTCCACAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 11903
Forward primer (5'-3')
AGCACCATTTGAGAAAAATATACCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCCAAGGAATGAAACATTCCACAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 13859
Forward primer (5'-3')
AGCACCATTTGAGAAAAATATACCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCCAAGGAATGAAACATTCCACAC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13860
Forward primer (5'-3')
AGCACCATTTGAGAAAAATATACCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCCAAGGAATGAAACATTCCACAC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13861
Forward primer (5'-3')
AGCACCATTTGAGAAAAATATACCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCCAAGGAATGAAACATTCCACAC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 13862
Forward primer (5'-3')
AGCACCATTTGAGAAAAATATACCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCCAAGGAATGAAACATTCCACAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 13863
Forward primer (5'-3')
AGCACCATTTGAGAAAAATATACCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCCAAGGAATGAAACATTCCACAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 13864
Forward primer (5'-3')
AGCACCATTTGAGAAAAATATACCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCCAAGGAATGAAACATTCCACAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 13865
Forward primer (5'-3')
AGCACCATTTGAGAAAAATATACCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCCAAGGAATGAAACATTCCACAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 13866
Forward primer (5'-3')
AGCACCATTTGAGAAAAATATACCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCCAAGGAATGAAACATTCCACAC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13867
Forward primer (5'-3')
AGCACCATTTGAGAAAAATATACCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCCAAGGAATGAAACATTCCACAC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13868
Forward primer (5'-3')
AGCACCATTTGAGAAAAATATACCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCCAAGGAATGAAACATTCCACAC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 32658
Forward primer (5'-3')
AGCACCATTTGAGAAAAATATACCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCCAAGGAATGAAACATTCCACAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 33261
Forward primer (5'-3')
AGCACCATTTGAGAAAAATATACCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCCAAGGAATGAAACATTCCACAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 33262
Forward primer (5'-3')
AGCACCATTTGAGAAAAATATACCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCCAAGGAATGAAACATTCCACAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 33263
Forward primer (5'-3')
AGCACCATTTGAGAAAAATATACCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCCAAGGAATGAAACATTCCACAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 33264
Forward primer (5'-3')
AGCACCATTTGAGAAAAATATACCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCCAAGGAATGAAACATTCCACAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 33265
Forward primer (5'-3')
AGCACCATTTGAGAAAAATATACCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCCAAGGAATGAAACATTCCACAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 33266
Forward primer (5'-3')
AGCACCATTTGAGAAAAATATACCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCCAAGGAATGAAACATTCCACAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 11904
Forward primer (5'-3')
AGCACCATTTGAGAAAAATATACCTG
Digested band sizes (using AluI)
Solanum lycopersicum LA925: 320+420
Solanum pennellii LA716: 320+520
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCCAAGGAATGAAACATTCCACAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI
  
Accessions and product sizes
Solanum pennellii LA716: 850
Solanum lycopersicum LA925: 850
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At5g42740 was used as an overgo probe on plate 13 [well E11]

Plausible BAC Matches:   P315J01,   P049O20,   P069K15,   P216N06,   P309C07,   P155M10,   P070K23,   P208M14,   P069M12,   P061A01,   P007F23,   P104J17,   P018B15,   P261F24,   P077B14,   P232P05,   P036N05,   P199M12,   P049J09,   P176F21,   P131O19,   P104H19,   P305E09,   P163E02,   P279A21

 Overgo Sequences

A sequence
TGGTATAGGTGGCAGTTTCTTGGG
B sequence
GTGTACGAACAAAGGGCCCAAGAA
AB sequence
TGGTATAGGTGGCAGTTTCTTGGGCCCTTT
Marker sequence
ATGGCTTCATCTGCTTTAATTAGCGATACTCAGTCATGGAAGGATTTGCG
AGCTCATGTTGAAGAAATTAACAAAACTCATTTGCGTGATTNNNNNTGTT
GAATCACACTGATCGATGTCAATCAATGATGGTGGAGTTTGATGGGATTC
TGNNNNNATCGATTACTCGAGACAAAGAGCCACCCTTGATACATTGAAAA
AGCTCTTCAATTTAGCTGAGGCAGCACATGTTAANNNNNGGAGAAGATTA
TTCGGATGTTCAATGGAGAGCATATAAACAGCACAGAAAACAGACCCGTT
CTTCATGTTGCACTGCGTGCTNNNNNCCAAGGGATGCAGTCATAAATAGT
GACGGGAAGAATGTTGTTCCTGAGNNNNNGTTTGGCATGTACTTGATAAG
ATCCGAGACTTCTCTGAGAGGGTTCGCAGTGGTTCCTGGGTTGGAGCCAC
AGGAAAAGCATTGAAAGATGTTGTAGCTGTTGGTATAGGTGGCAGTTTCT
TGGGCCCTTTGTTCGTACACACAGCACTTCAAACANNNNNGAAGCGGAGG
CTAGTGAGTGTGCAAGAGGGCGCCAGTTGCGATTTCTCGCGAATGTTGAT
CCAATTGATGTAGCCCGAAATATAACAGGCTTGAATCNNNNNCTGAAACA
ACTCTAGTTGTGGTGGTCTCAAAGACTTTTACTACNNNNNAGCCGAGACA
ATGCTAAATGCCCGTACAATGAGGGAATGGATCTCCTCTGCATTAGGACC
TCAGGCAGNNNNNTTGCAAAGCATATGGTTGCAGTTAGTACCAATCTTAA
GCTCGTAGAACAATTTGGCATTGATCCAAATAATGCATTCGCTTTCTGNN
NNNGGACTGGGTAGGAGGTCGATTTAGTGTCTGCAGTGCAGTTGGAGTAT
TGNNNNNCCTCTTTCTCTGCAATATGGTTTTTCCATTGTTGAGAAATTTC
TGAAGGGAGCTTCAAGTGTTGATCAGCATTNNNNNTCCTCTCAGCACCAT
TTGAGAAAAATATACCTGTGCTTTTAGGCTTGCTGAGTGTGTGGAANNNN
NTGTTTCATTCCTTGGATATCCAGCAAGAGCAATATTACCCTATTCTCAA
GCACTGGAGAAGTTGGCANNNNNCCTCATATTCAACAGGTCAGTATGGAG
AGTAATGGGAAAGGGGTGTCAATTGATGGTNNNNNGTCCCTCTTCCTTAT
CAGACTGGTGAAATTGACTTTGGTGAACCAGGGACGAATNNNNNGGCCAA
CACAGCTTTTACCAATTAATTCACCAGGGCCGTGTTATTCCTTGTGATTT
TATTGGTGTTGTTAAGAGTCAGCAGCCTATTTACCTAAAAGATGAAGTGG
TGAATAACCATGATGAGCTCATGNNNNNTCGAACTTCTTTGCGCAGCCAG
ATGCCCTTGCTTATGGGAAGACACCAGAGCAGTTGCAAAAGGNNNNNAGA
ATATTCCTGAGCATCTTGTTTCTCATAAGACATTTTCTGGAAATCGACCT
TCTCTAAGTATACTACTTCCANNNNNTCATTGTCTGCTTACAATATTGGA
CAGTTACTGGCCATCTACGAGCACAGAGTTNNNNNGCAGTCCAAGGCTTC
GTATGGGGTATCAATTCTTTTGATCAGTGGGGTGTGGAGCTAGGAAAGTC
TCTANNNNNGCGACTCAAGTTAGAAAGCAACTTCATGCATCTCGTAAGAA
AGGAGAATCAGTTGAAGGCTTCAATTTCAGCACCAAAATGTTGATAACAA
GATATCTCGAGGCAAGTGCTGATGTTCCTTCTGATCCTTCAACTCTTCTG
CCAAATATATGANNNNN
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 120061 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120061 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, plain text
Forward amplicon sequence for S. hirtum 120060 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120060 plant #1, plain text
Forward amplicon sequence for S. hirtum 120062 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #1, plain text
Forward amplicon sequence for S. hirtum 120071 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120071 plant #2, plain text


BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 120061 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120061 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, plain text
Forward amplicon sequence for S. hirtum 120060 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120060 plant #1, plain text
Forward amplicon sequence for S. hirtum 120062 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #1, plain text
Forward amplicon sequence for S. hirtum 120071 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120071 plant #2, plain text

Genomic location of C2_At5g42740  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4677 marker 4677
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)