SGN Marker C2_At5g54310

SGN-M4691
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301021 (SGN)
122077 (CGN)
---
Capsicum annuumSingleSGN-U197664---
Lycopersicon CombinedSingleSGN-U217784---
Solanum tuberosumSingleSGN-U245336---
ArabidopsisSingleAt5g54310 on TAIR---
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132194)
Chromosome
7
Position
74.87 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46778)
Chromosome
7
Position
29.90 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38892)
Chromosome
7
Position
75.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39994
Forward primer (5'-3')
AGAAGCCTGGGGGTGCACATATC
Accessions and product sizes
Solanum pennellii TA56
1300
Solanum lycopersicum TA209
1300
Approximate temperature
50°C
Reverse primer (5'-3')
AACTTGTTCAGGAAGCCATGTGTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
480+800
Solanum lycopersicum TA209
480+750
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27547)
Chromosome
5
Position
22.08 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 12018
Forward primer (5'-3')
AGAAGCCTGGGGGTGCACATATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTTGTTCAGGAAGCCATGTGTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1300
Approximate temperature
50°C
  
PCR data   Exp. ID 12019
Forward primer (5'-3')
AGAAGCCTGGGGGTGCACATATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTTGTTCAGGAAGCCATGTGTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Approximate temperature
50°C
  
PCR data   Exp. ID 12020
Forward primer (5'-3')
AGAAGCCTGGGGGTGCACATATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTTGTTCAGGAAGCCATGTGTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1300
Approximate temperature
50°C
  
PCR data   Exp. ID 12021
Forward primer (5'-3')
AGAAGCCTGGGGGTGCACATATC
Digested band sizes (using DraI)
Solanum lycopersicum LA925: 480+750
Solanum pennellii LA716: 480+800
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTTGTTCAGGAAGCCATGTGTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: DraI
All possible enzymes for lycopersicum and pimpinellifolium: DraI
  
Accessions and product sizes
Solanum pennellii LA716: 1300
Solanum lycopersicum LA925: 1300
Approximate temperature
50°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At5g54310 was used as an overgo probe on plate 13 [well G9]

Plausible BAC Matches:   P289M04,   P249O17

 Overgo Sequences

A sequence
TAAGTTGCCCGAGAACAGGGAATG
B sequence
GGCTTTGCAATCTGCACATTCCCT
AB sequence
TAAGTTGCCCGAGAACAGGGAATGTGCAGA
Marker sequence
ATGAATGAGAAGGCTAATGTTACTAAAGAGCTTAATGCGAAGCATAGAAA
GNNNNNATACTAGAAGGACTTCTTAAGTTGCCCGAGAACAGGGAATGTGC
AGATTGCAAAGCCAANNNNNGGGTCCTAGATGGGCAAGCGTGAACCTGGG
AATATTTATATGCATGCAATGCTCTGGGATCCACAGAAGCCTGGGGGTGC
ACATATCAAAGNNNNNGTCAGATCAGCTACACTAGACACATGGCTTCCTG
AACAAGTTGCATTTATCCATTNNNNNCAATGGGAAATGAGAGGTCAAATA
GTTTTTGGGAAGCAGAGCTGCCTCCAAATTATGATAGAGTTGGTATTGAG
AATTTCATCCGAGCAAANNNNNATATGAAGAGAAGAGGTGGGTCCCTAAG
GATGGGATTCAAAAATCACCTTCCAGGGTTCAAGAAGAGAGGGCTTCGGT
GCAATGGCAACAAAACAATGATAGAAGTGGGCGTATACATGCAGCTAGCT
CAAGATGTGCATCTGACGAGAGGAAAAATATTCAAGCCTCGAAAGTGAAG
CAAGATGTACCTGCTNNNNNNNNNNNNNNNNNNNNNNNNN
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At5g54310  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4691 marker 4691
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)