SGN Marker Pto

SGN-M4705
KFG markers are Known Function Genes

SynonymsNone
Locus associations  
This marker is associated with the Pseudomonas syringae pv tomato resis. locus.

Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39156)
Chromosome
5
Position
62.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35586
Forward primer (5'-3')
GTGCAGAGAGTACTGGAGGACCTG
Digested band sizes (using RsaI)
Solanum pennellii LA716: 300+400
Solanum lycopersicum LA925: 200+300
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GTCTGAATGAACATGATCAAAGTA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 850
Solanum pennellii LA716: 850
Approximate temperature
55°C
  
Genomic location of Pto  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4705 marker 4705
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)