SGN Marker DDB1

SGN-M4710
KFG markers are Known Function Genes

SynonymsNone
Locus associations  
This marker is associated with the UV damaged DNA binding protein 1 locus.

Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39089)
Chromosome
2
Position
0.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 13956
Forward primer (5'-3')
GCAATCGCTAAAGAAGGTGAGT
Digested band sizes (using PstI)
Solanum pennellii LA716: 1300
Solanum lycopersicum LA925: 550+750
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GCATTATAGTCTCTGGCTCGCT
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Solanum pennellii LA716: 1300
Approximate temperature
58°C
  
PCR data   Exp. ID 13956
Forward primer (5'-3')
GCAATCGCTAAAGAAGGTGAGT
Digested band sizes (using PstI)
Solanum pennellii LA716: 1300
Solanum lycopersicum LA925: 550+750
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GCATTATAGTCTCTGGCTCGCT
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1300
Solanum lycopersicum LA925: 1300
Approximate temperature
58°C
  
Unigene blast matches for primers 
Genomic location of DDB1  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4710 marker 4710
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)