SGN Marker C2_At2g24270

SGN-M4716
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle299764 (SGN)
121712 (CGN)
---
Capsicum annuumSingleSGN-U196761---
Lycopersicon CombinedSingleSGN-U214796---
Solanum tuberosumMultipleSGN-U244559---
ArabidopsisSingleAt2g24270 on TAIR---
Mapped locations  
Map: Tobacco N. acuminata   
Map version
89 (location: 46461)
Chromosome
11
Position
3.10 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41374)
Chromosome
7
Position
21.40 cM
Confidence
F(LOD3)
Protocol
PCR


Pepper-COSII

PCR data   Exp. ID 43350
Forward primer (5'-3')
TGGAAATGAAAGGACCAAATACTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGGAGCAATCTTGGAGACGGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38321)
Chromosome
7
Position
0.30 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39581
Forward primer (5'-3')
TGGAAATGAAAGGACCAAATACTG
Accessions and product sizes
Solanum pennellii TA56
1000
Solanum lycopersicum TA209
1000
Approximate temperature
55°C
Reverse primer (5'-3')
AGGAGCAATCTTGGAGACGGC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
700
Solanum lycopersicum TA209
550
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25698)
Chromosome
2
Position
10.34 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10645
Forward primer (5'-3')
TGGAAATGAAAGGACCAAATACTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAGCAATCTTGGAGACGGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 10646
Forward primer (5'-3')
TGGAAATGAAAGGACCAAATACTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAGCAATCTTGGAGACGGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 10647
Forward primer (5'-3')
TGGAAATGAAAGGACCAAATACTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAGCAATCTTGGAGACGGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 12981
Forward primer (5'-3')
TGGAAATGAAAGGACCAAATACTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAGCAATCTTGGAGACGGC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 12982
Forward primer (5'-3')
TGGAAATGAAAGGACCAAATACTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAGCAATCTTGGAGACGGC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 12983
Forward primer (5'-3')
TGGAAATGAAAGGACCAAATACTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAGCAATCTTGGAGACGGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 12984
Forward primer (5'-3')
TGGAAATGAAAGGACCAAATACTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAGCAATCTTGGAGACGGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 12985
Forward primer (5'-3')
TGGAAATGAAAGGACCAAATACTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAGCAATCTTGGAGACGGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 12986
Forward primer (5'-3')
TGGAAATGAAAGGACCAAATACTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAGCAATCTTGGAGACGGC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 12987
Forward primer (5'-3')
TGGAAATGAAAGGACCAAATACTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAGCAATCTTGGAGACGGC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 32923
Forward primer (5'-3')
TGGAAATGAAAGGACCAAATACTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAGCAATCTTGGAGACGGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 32924
Forward primer (5'-3')
TGGAAATGAAAGGACCAAATACTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAGCAATCTTGGAGACGGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 32925
Forward primer (5'-3')
TGGAAATGAAAGGACCAAATACTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAGCAATCTTGGAGACGGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 10648
Forward primer (5'-3')
TGGAAATGAAAGGACCAAATACTG
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 550
Solanum pennellii LA716: 700
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAGCAATCTTGGAGACGGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI, HinfI
All possible enzymes for lycopersicum and pimpinellifolium: AluI, HinfI
  
Accessions and product sizes
Solanum pennellii LA716: 1000
Solanum lycopersicum LA925: 1000
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At2g24270  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4716 marker 4716
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)