SGN Marker C2_At5g51110

SGN-M4733
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303201 (SGN)
125097 (CGN)
---
Capsicum annuumSingleSGN-U198452---
Lycopersicon CombinedSingleSGN-U215086---
Solanum tuberosumMultipleSGN-U246189---
ArabidopsisSingleAt5g51110 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46776)
Chromosome
3
Position
27.40 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46537)
Chromosome
3
Position
34.60 cM
Confidence
CF(LOD3)
Protocol
dCAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38885)
Chromosome
3
Position
75.70 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39987
Forward primer (5'-3')
TGGTGGAAGGCACAGGGCAC
Accessions and product sizes
Solanum lycopersicum TA209
220
Solanum pennellii TA56
250
Approximate temperature
55°C
Reverse primer (5'-3')
TCTTTACTTGATCTATTTTAGCAGC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
250
Solanum lycopersicum TA209
220
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27502)
Chromosome
5
Position
20.80 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11990
Forward primer (5'-3')
TGGTGGAAGGCACAGGGCAC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCTTTACTTGATCTATTTTAGCAGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 360
Approximate temperature
55°C
  
PCR data   Exp. ID 11991
Forward primer (5'-3')
TGGTGGAAGGCACAGGGCAC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCTTTACTTGATCTATTTTAGCAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 11992
Forward primer (5'-3')
TGGTGGAAGGCACAGGGCAC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCTTTACTTGATCTATTTTAGCAGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 340
Approximate temperature
55°C
  
PCR data   Exp. ID 13911
Forward primer (5'-3')
TGGTGGAAGGCACAGGGCAC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCTTTACTTGATCTATTTTAGCAGC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13912
Forward primer (5'-3')
TGGTGGAAGGCACAGGGCAC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCTTTACTTGATCTATTTTAGCAGC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 13913
Forward primer (5'-3')
TGGTGGAAGGCACAGGGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTTTACTTGATCTATTTTAGCAGC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13914
Forward primer (5'-3')
TGGTGGAAGGCACAGGGCAC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCTTTACTTGATCTATTTTAGCAGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13915
Forward primer (5'-3')
TGGTGGAAGGCACAGGGCAC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCTTTACTTGATCTATTTTAGCAGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13916
Forward primer (5'-3')
TGGTGGAAGGCACAGGGCAC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCTTTACTTGATCTATTTTAGCAGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13917
Forward primer (5'-3')
TGGTGGAAGGCACAGGGCAC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCTTTACTTGATCTATTTTAGCAGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13918
Forward primer (5'-3')
TGGTGGAAGGCACAGGGCAC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCTTTACTTGATCTATTTTAGCAGC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13919
Forward primer (5'-3')
TGGTGGAAGGCACAGGGCAC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCTTTACTTGATCTATTTTAGCAGC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13920
Forward primer (5'-3')
TGGTGGAAGGCACAGGGCAC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCTTTACTTGATCTATTTTAGCAGC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13921
Forward primer (5'-3')
TGGTGGAAGGCACAGGGCAC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCTTTACTTGATCTATTTTAGCAGC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 32661
Forward primer (5'-3')
TGGTGGAAGGCACAGGGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTTTACTTGATCTATTTTAGCAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 33287
Forward primer (5'-3')
TGGTGGAAGGCACAGGGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTTTACTTGATCTATTTTAGCAGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 340
Approximate temperature
55°C
  
PCR data   Exp. ID 33288
Forward primer (5'-3')
TGGTGGAAGGCACAGGGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTTTACTTGATCTATTTTAGCAGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 360
Approximate temperature
55°C
  
PCR data   Exp. ID 33289
Forward primer (5'-3')
TGGTGGAAGGCACAGGGCAC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCTTTACTTGATCTATTTTAGCAGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 33290
Forward primer (5'-3')
TGGTGGAAGGCACAGGGCAC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCTTTACTTGATCTATTTTAGCAGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 33291
Forward primer (5'-3')
TGGTGGAAGGCACAGGGCAC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCTTTACTTGATCTATTTTAGCAGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 33292
Forward primer (5'-3')
TGGTGGAAGGCACAGGGCAC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCTTTACTTGATCTATTTTAGCAGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 11993
Forward primer (5'-3')
TGGTGGAAGGCACAGGGCAC
Digested band sizes (using amplicon difference)
Solanum lycopersicum LA925: 320
Solanum pennellii LA716: 360
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCTTTACTTGATCTATTTTAGCAGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
All possible enzymes for lycopersicum and pimpinellifolium: amplicon difference
  
Accessions and product sizes
Solanum pennellii LA716: 360
Solanum lycopersicum LA925: 320
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At5g51110  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4733 marker 4733
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)