SGN Marker CT148

SGN-M528

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1100
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
TCTCCAATTAAGCTTCGCGAAGAATCTACAAAAAAAGAGTCCTCCTTCAGCTCTTCATATGGAAACGCATTCTTCAAATCACCAAACTTC
CTCCGATAATGGAGTCGTTTTGCCTGAGTTGCTGACAGAGTTTATGGTGGATATGTCGTGTCAAGGCTGTGTTAGTGCTGTCAAGAGCAA
ATTGCAAACCGTAGAAGGAGTCAAGAATGTAGATGTGGATCTTGATAATCAAGTAGTGAGAATTCTTGGATCTTCACCTGTGAAGACAAT
GACTGAAGCCTTGGAGCAAACAGGTCGAAAAGCCCGTCTGATTGGGCAAGGAGTACCGGATGATTTCCTTATATCTGCTGCCGTTGCCGA
ATTCAAAGGACCAGATATTTTTGGTGTTGTTCGCTTGGCTCAAGTCAATATGGAATTAACTAGGATTGAAGCAAACTTCAGTGGCCTGTC
ACCTGGGAAGCATGCTTGGTCTATTAATGAATTTGG
Reverse sequence
not available
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1619311.3e-3575 (15.4% of RFLP seq)+
SGN-U1619313e-175330 (67.9% of RFLP seq)+
SGN-U146683486 (100.0% of RFLP seq)+
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 51865)
Chromosome
8
Position
92.55 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_8 MQTL_1_Maturity_8 MQTL_2_Late_blight_8
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49320)
Chromosome
8
Position
60.44 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47258)
Chromosome
8
Position
85.26 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-LXCHM 2007   
Map version
68 (location: 42952)
Chromosome
8
Position
31.90 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43952
Forward primer (5'-3')
AGTCCTCCTTCAGCTCTTCATA
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
ATTCGGCAAGGCCAGCAGATA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Eggplant-COSII   
Map version
63 (location: 42302)
Chromosome
8
Position
99.40 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38979)
Chromosome
8
Position
67.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 9393)
Chromosome
8
Position
78.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9392)
Chromosome
8
Position
74.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT148 was used as an overgo probe on plate 11 [well G12]

Plausible BAC Matches:   P020K14,   P066O08,   P165B06,   P004P13,   P036F16

 Overgo Sequences

A sequence
CCTCCGATAATGGAGTCGTTTTGC
B sequence
TCTGTCAGCAACTCAGGCAAAACG
AB sequence
CCTCCGATAATGGAGTCGTTTTGCCTGAGT
Marker sequence
TCTCCAATTAAGCTTCGCGAAGAATCTACAAAAAAAGAGTCCTCCTTCAG
CTCTTCATATGGAAACGCATTCTTCAAATCACCAAACTTCCTCCGATAAT
GGAGTCGTTTTGCCTGAGTTGCTGACAGAGTTTATGGTGGATATGTCGTG
TCAAGGCTGTGTTAGTGCTGTCAAGAGCAAATTGCAAACCGTAGAAGGAG
TCAAGAATGTAGATGTGGATCTTGATAATCAAGTAGTGAGAATTCTTGGA
TCTTCACCTGTGAAGACAATGACTGAAGCCTTGGAGCAAACAGGTCGAAA
AGCCCGTCTGATTGGGCAAGGAGTACCGGATGATTTCCTTATATCTGCTG
CCGTTGCCGAATTCAAAGGACCAGATATTTTTGGTGTTGTTCGCTTGGCT
CAAGTCAATATGGAATTAACTAGGATTGAAGCAAACTTCAGTGGCCTGTC
ACCTGGGAAGCATGCTTGGTCTATTAATGAATTTGG
Genomic location of CT148  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D528 marker 528
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)