SGN Marker CT53

SGN-M60

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
900
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT53 image not available
Forward sequence
TTTTTTTTTTTTTTAATGTACATATAGAAGTGAATCAATATATACTAGAAGTGATTAATATAATTCAAATCAAATGAACAAAAATAATCC
TTATTAGGCCTATTAATATGTGTACTTCACACGTAAACTATGTAAATTACAAAATAAAAATTATTTTTATATTGTTACCTGATTTTAAAA
TTTCTAACTCTTTGAATACATAGGAATAATTAGAAGAAAATTATGATTTTATAGTAAATTATATATAAACGTATGGAAAAATATTAAAAT
AAACTTTAAAAATATTTTCGATTAAACTATGTAGGTATTATAGGAAGAAGATGGCAAGGGTCTTGCTTTACTTTGACCAAAAAATAAAAA
TTAGCATTGTATTTAGCTAAGAATTATACTAGTCATATTTGAAATAACACTA
Reverse sequence
CTTTTTTTTTTTTTGTTAGAATAAATCAATCAATCATTTTTAAAAAAAATATAAAGCTAAATAGAAATGAAAATTGACGACACCTTAACT
AACACGATGTTTACGATTAGAAAAAGCCAATAACTGCTACGTACCAGAAAATTTCAACGGTCTTTCAGTTACAATGCACCTTGTGCGCAC
GCTAGCACTATGGAAACGTCATTGTTCCTTGCCAAGTCAATAATCATAATATAATAACAATAATAATAATTTGATTTAATAAATACTTCG
AGATAGAATGAAAAAAATTGAATTTGATTAATTCAATAAAAAATAGGAAAATTTGTTAGGCAAGCTATTGTTCCATTCAAATATAAATTA
ATCTTGCTTACAAGATGAAAATTTAAAATATTTACAAAAGTTAGAACTTAATATCTAATACACAATAGAAACAA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39056)
Chromosome
5
Position
13.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 7906)
Chromosome
5
Position
5.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7907)
Chromosome
5
Position
4.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT53 was used as an overgo probe on plate 5 [well B9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATAGGAAGAAGATGGCAAGGGTCT
B sequence
TGGTCAAAGTAAAGCAAGACCCTT
AB sequence
ATAGGAAGAAGATGGCAAGGGTCTTGCTTT
Marker sequence
TTTTTTTTTTTTTTAATGTACATATAGAAGTGAATCAATATATACTAGAA
GTGATTAATATAATTCAAATCAAATGAACAAAAATAATCCTTATTAGGCC
TATTAATATGTGTACTTCACACGTAAACTATGTAAATTACAAAATAAAAA
TTATTTTTATATTGTTACCTGATTTTAAAATTTCTAACTCTTTGAATACA
TAGGAATAATTAGAAGAAAATTATGATTTTATAGTAAATTATATATAAAC
GTATGGAAAAATATTAAAATAAACTTTAAAAATATTTTCGATTAAACTAT
GTAGGTATTATAGGAAGAAGATGGCAAGGGTCTTGCTTTACTTTGACCAA
AAAATAAAAATTAGCATTGTATTTAGCTAAGAATTATACTAGTCATATTT
GAAATAACACTA
Genomic location of CT53  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D60 marker 60
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)