SGN Marker CT250

SGN-M613

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
800
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT250 image not available
Forward sequence
AAAACACTCTTTGGACTGTCGCTTTAGTATATGGATTCTTTAAACAGGTTACACTTCCTCTTTCTGGTAGGAACTTCATATTGACGCTAA
TTGCTAGACGATCTCGTCATTATGCTGGTACCAGATATTTGAAAAGAGGTGTAAATGAGAAGGGTCGCGTAGCAAATGATGTAGAAACAG
AACAAATTGTGCTTGAAGATGTGCCTGCTGGGTGCCCGCTCCAAATAAGTGCTGTTGTGCAAAATCGGGGTTCAATACCTCTTTTTTGGT
CTCAAGAGACGTCACGTTTGAATATTAAGCCTGACATCATACTCTCTAGGAAGGACTTGAATTTTGAAGCCACCAAACGTCACTTTGAGA
ATCTTGTGAAGAGATATGGAAATCCAATTATAATATTGAATTTGATTAAGACTCGTGAGAAGCGGCCAAGAGAAACTATTCTTCGTGCAG
CATTTGCTAATGCTATTGAGTTTATAAATAAAGATCTTT
Reverse sequence
not available
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1672655.6e-0735 (7.2% of RFLP seq)+
SGN-U148013489 (100.0% of RFLP seq)+
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53767)
Chromosome
3
Position
121.10 cM
Confidence
uncalculated
Protocol
RFLP

Titratable_acidity_ta3_1 Fruit_diameter_fd3_1 Elasticity_ela3_1 Fruit_weight_fw3_1 2_Phenylethanal_content_pea3_1 Carotene_content_car3_1 Sugar_content_suc3_1
Tomato QTL map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9627)
Chromosome
3
Position
123.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT250 was used as an overgo probe on plate 2 [well C1]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P246I24,   P217A14,   P074N04,   P219B10,   P080P20

 Overgo Sequences

A sequence
TGCCCGCTCCAAATAAGTGCTGTT
B sequence
AACCCCGATTTTGCACAACAGCAC
AB sequence
TGCCCGCTCCAAATAAGTGCTGTTGTGCAA
Marker sequence
AAAACACTCTTTGGACTGTCGCTTTAGTATATGGATTCTTTAAACAGGTT
ACACTTCCTCTTTCTGGTAGGAACTTCATATTGACGCTAATTGCTAGACG
ATCTCGTCATTATGCTGGTACCAGATATTTGAAAAGAGGTGTAAATGAGA
AGGGTCGCGTAGCAAATGATGTAGAAACAGAACAAATTGTGCTTGAAGAT
GTGCCTGCTGGGTGCCCGCTCCAAATAAGTGCTGTTGTGCAAAATCGGGG
TTCAATACCTCTTTTTTGGTCTCAAGAGACGTCACGTTTGAATATTAAGC
CTGACATCATACTCTCTAGGAAGGACTTGAATTTTGAAGCCACCAAACGT
CACTTTGAGAATCTTGTGAAGAGATATGGAAATCCAATTATAATATTGAA
TTTGATTAAGACTCGTGAGAAGCGGCCAAGAGAAACTATTCTTCGTGCAG
CATTTGCTAATGCTATTGAGTTTATAAATAAAGATCTTT
Genomic location of CT250  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D613 marker 613
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)