SGN Marker CT255

SGN-M620

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
500
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
CCAAAGGACCATCCATATGATCCTGCCCATGATTCTGTTCTATCACGAGTGAAGTATCTCTTCTCTACTGAATCAGTAGCTGGCGATAGG
CGTTAATGTTGGAGTAATGTTTCTATGCCCCAACTATTTCATAATTATCTTGATATTGTATCATGTCCCCACTCTATCAAGAGATGATTC
ATTTTGTAATCTGTTTTAGATATTTAAGCGGTTTGTGTTGTTCTCGACTGTTGATTTTCAAGTTGTATAAGTTAAAAGTGACTGTGAATG
AACAACTTGTTGCAAATAAGTCAGTTGCTCTGTTCTTTGGGAGGTTCAATTGATATTATGAATGATTATTCTTGAAGAGGAATCAAATAA
ACTATTTGAGGACTGAAAAAAAAAAAAAAAAAAA
Reverse sequence
not available
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U149290345 (87.6% of RFLP seq)+
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49339)
Chromosome
2
Position
32.98 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47276)
Chromosome
2
Position
35.54 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39037)
Chromosome
2
Position
31.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 9649)
Chromosome
2
Position
23.00 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9650)
Chromosome
2
Position
27.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT255 was used as an overgo probe on plate 16 [well A8]

Plausible BAC Matches:   P231I01

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CCAAAGGACCATCCATATGATCCT
B sequence
GAACAGAATCATGGGCAGGATCAT
AB sequence
CCAAAGGACCATCCATATGATCCTGCCCAT
Marker sequence
CCAAAGGACCATCCATATGATCCTGCCCATGATTCTGTTCTATCACGAGT
GAAGTATCTCTTCTCTACTGAATCAGTAGCTGGCGATAGGCGTTAATGTT
GGAGTAATGTTTCTATGCCCCAACTATTTCATAATTATCTTGATATTGTA
TCATGTCCCCACTCTATCAAGAGATGATTCATTTTGTAATCTGTTTTAGA
TATTTAAGCGGTTTGTGTTGTTCTCGACTGTTGATTTTCAAGTTGTATAA
GTTAAAAGTGACTGTGAATGAACAACTTGTTGCAAATAAGTCAGTTGCTC
TGTTCTTTGGGAGGTTCAATTGATATTATGAATGATTATTCTTGAAGAGG
AATCAAATAAACTATTTGAGGACTGAAAAAAAAAAAAAAAAAAA
Genomic location of CT255  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D620 marker 620
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)