SGN Marker C2_At1g03360

SGN-M6489
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303427 (SGN)
121155 (CGN)
---
Capsicum annuumSingleSGN-U202249---
Lycopersicon CombinedSingleSGN-U237566---
Solanum tuberosumSingleSGN-U250537---
ArabidopsisSingleAt1g03360 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46543)
Chromosome
1
Position
80.80 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46421)
Chromosome
1
Position
77.90 cM
Confidence
F(LOD3)
Protocol
PCR


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38054)
Chromosome
9
Position
56.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39358
Forward primer (5'-3')
AGGCATACAGTTATCTTTCAGCAACAC
Accessions and product sizes
Solanum lycopersicum TA209
800
Solanum pennellii TA56
800
Approximate temperature
55°C
Reverse primer (5'-3')
AGAGCATTAGTACAGCGTCTTGGC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
800
Solanum lycopersicum TA209
350
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 24886)
Chromosome
1
Position
0.83 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g03360  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6489 marker 6489
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)