SGN Marker C2_At1g09920

SGN-M6567
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeMultiple299927 (SGN)
121064 (CGN)
---
Capsicum annuumSingleSGN-U196899---
Lycopersicon CombinedMultipleSGN-U215428---
Solanum tuberosumSingleSGN-U251570---
ArabidopsisSingleAt1g09920 on TAIR---
Mapped locations  
Map: Tobacco N. acuminata   
Map version
89 (location: 46426)
Chromosome
12
Position
34.30 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Eggplant-COSII   
Map version
63 (location: 42163)
Chromosome
4
Position
83.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43726
Forward primer (5'-3')
TTTGGGGCGGAGTAATGGCTGT
Accessions and product sizes
Approximate temperature
53°C
Reverse primer (5'-3')
TCCGGGAGCAGTGAGCAAAATG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41294)
Chromosome
4
Position
111.60 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43270
Forward primer (5'-3')
TTTGGGGCGGAGTAATGGCTGT
Accessions and product sizes
Approximate temperature
63°C
Reverse primer (5'-3')
TCCGGGAGCAGTGAGCAAAATG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38083)
Chromosome
12
Position
80.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39378
Forward primer (5'-3')
TCGATCTTCATTTTGCTCACTGCTC
Accessions and product sizes
Solanum pennellii TA56
580
Solanum lycopersicum TA209
580
Approximate temperature
55°C
Reverse primer (5'-3')
ATCCTTTTTGGGCAATTTTCACC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 24965)
Chromosome
1
Position
3.23 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 9981
Forward primer (5'-3')
TCGATCTTCATTTTGCTCACTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCCTTTTTGGGCAATTTTCACC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 2200
Approximate temperature
55°C
  
PCR data   Exp. ID 9982
Forward primer (5'-3')
TCGATCTTCATTTTGCTCACTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCCTTTTTGGGCAATTTTCACC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2200
Approximate temperature
55°C
  
PCR data   Exp. ID 9983
Forward primer (5'-3')
TCGATCTTCATTTTGCTCACTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCCTTTTTGGGCAATTTTCACC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 2200
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At1g09920  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6567 marker 6567
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)