SGN Marker C2_At1g11860

SGN-M6586
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle308520 (SGN)
127945 (CGN)
---
Capsicum annuumSingleSGN-U197968---
Lycopersicon CombinedMultipleSGN-U213912---
Solanum tuberosumSingleSGN-U245114---
ArabidopsisSingleAt1g11860 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 24985)
Chromosome
1
Position
4.00 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41024
Forward primer (5'-3')
AGGGTTTTGGATATCAATGGGGC
Accessions and product sizes
Solanum pennellii TA56
2000
Solanum lycopersicum TA209
2000
Approximate temperature
55°C
Reverse primer (5'-3')
AGAGAAAAAGCCAACTCGCCTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 10002
Forward primer (5'-3')
AGGGTTTTGGATATCAATGGGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGAAAAAGCCAACTCGCCTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 10003
Forward primer (5'-3')
AGGGTTTTGGATATCAATGGGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGAAAAAGCCAACTCGCCTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 10004
Forward primer (5'-3')
AGGGTTTTGGATATCAATGGGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGAAAAAGCCAACTCGCCTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 750
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g11860F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At1g11860  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6586 marker 6586
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)