SGN Marker C2_At1g15200

SGN-M6618
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301192 (SGN)
124135 (CGN)
---
Lycopersicon CombinedSingleSGN-U237164---
ArabidopsisSingleAt1g15200 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25020)
Chromosome
1
Position
5.23 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41033
Forward primer (5'-3')
TAGTGGAGAAGACGGAGGAAGAGC
Accessions and product sizes
Solanum lycopersicum TA209
1100
Solanum pennellii TA56
1100
Approximate temperature
58°C
Reverse primer (5'-3')
TTGGATCCTTAAGCCGCTCAG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
1100
Solanum lycopersicum TA209
700
Mg+2 concentration
1.5mM
   Enzymes
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g15200  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6618 marker 6618
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)