SGN Marker C2_At1g24340

SGN-M6696
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U203258---
Lycopersicon CombinedSingleSGN-U226798---
ArabidopsisSingleAt1g24340 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49204)
Chromosome
5
Position
1.43 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47135)
Chromosome
5
Position
13.50 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46568)
Chromosome
6
Position
14.70 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Eggplant-COSII   
Map version
63 (location: 42175)
Chromosome
10
Position
66.20 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43738
Forward primer (5'-3')
ACAAATATTTGAAGAAGGACAGAGCCT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACGTCATCTTCAGACACCAATACTCCTTT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38133)
Chromosome
5
Position
12.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39421
Forward primer (5'-3')
ACAAATATTTGAAGAAGGACAGAGCCT
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
ACGTCATCTTCAGACACCAATACTCCTTT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25101)
Chromosome
1
Position
8.64 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g24340  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6696 marker 6696
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)