SGN Marker C2_At1g25540

SGN-M6706
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300337 (SGN)
122922 (CGN)
---
Lycopersicon CombinedMultipleSGN-U223975---
Solanum tuberosumSingleSGN-U245721---
ArabidopsisSingleAt1g25540 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25111)
Chromosome
1
Position
8.97 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41059
Forward primer (5'-3')
TTAGTCAGCTGCAAGAAAAGAAGC
Accessions and product sizes
Solanum lycopersicum TA209
550+950
Approximate temperature
45°C
Reverse primer (5'-3')
AGGAAAAAGCATTCCAATCAAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 10097
Forward primer (5'-3')
TTAGTCAGCTGCAAGAAAAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAAAAAGCATTCCAATCAAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 550+950
Approximate temperature
45°C
  
PCR data   Exp. ID 10098
Forward primer (5'-3')
TTAGTCAGCTGCAAGAAAAGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAAAAAGCATTCCAATCAAGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 550+950
Approximate temperature
45°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At1g25540  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6706 marker 6706
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)