SGN Marker C2_At1g33970

SGN-M6786
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301519 (SGN)
119544 (CGN)
---
Lycopersicon CombinedSingleSGN-U214875---
Solanum tuberosumMultipleSGN-U246997---
ArabidopsisSingleAt1g33970 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46583)
Chromosome
3
Position
4.70 cM
Confidence
F(LOD3)
Protocol
PCR


Tobacco N. tomentosiformis

Map: Eggplant-COSII   
Map version
63 (location: 42182)
Chromosome
12
Position
48.00 cM
Confidence
I
Protocol
dCAPS


Eggplant-COSII

PCR data   Exp. ID 43746
Forward primer (5'-3')
TTCAAAATACAACAGCATACCTAGTGA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCGTTTCCAACAAATTCAGGTTCAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41326)
Chromosome
5
Position
44.60 cM
Confidence
I(LOD2)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43302
Forward primer (5'-3')
TGGAAGTGCAATAAGTGATGATTGGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCGTTTCCAACAAATTCAGGTTCAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38172)
Chromosome
11
Position
50.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39453
Forward primer (5'-3')
TGGAAGTGCAATAAGTGATGATTGGG
Accessions and product sizes
Solanum pennellii TA56
300
Solanum lycopersicum TA209
300
Approximate temperature
55°C
Reverse primer (5'-3')
TCGTTTCCAACAAATTCAGGTTCAG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
175
Solanum pennellii TA56
300
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25192)
Chromosome
1
Position
12.35 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g33970  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6786 marker 6786
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)