SGN Marker C2_At1g46480

SGN-M6814
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309146 (SGN)
126578 (CGN)
---
Lycopersicon CombinedSingleSGN-U221816---
Solanum tuberosumSingleSGN-U255805---
ArabidopsisSingleAt1g46480 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46587)
Chromosome
4
Position
70.30 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46441)
Chromosome
4
Position
58.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41329)
Chromosome
4
Position
126.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43305
Forward primer (5'-3')
TAAGAGTTTCATTAGGCCTGAAAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TATCTGTTCTTGTGTTGGATTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38183)
Chromosome
4
Position
101.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39464
Forward primer (5'-3')
TAAGAGTTTCATTAGGCCTGAAAG
Accessions and product sizes
Solanum lycopersicum TA209
500
Solanum pennellii TA56
500
Approximate temperature
55°C
Reverse primer (5'-3')
TATCTGTTCTTGTGTTGGATTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25222)
Chromosome
1
Position
17.24 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10218
Forward primer (5'-3')
TAAGAGTTTCATTAGGCCTGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TATCTGTTCTTGTGTTGGATTCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 10219
Forward primer (5'-3')
TAAGAGTTTCATTAGGCCTGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TATCTGTTCTTGTGTTGGATTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 10220
Forward primer (5'-3')
TAAGAGTTTCATTAGGCCTGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TATCTGTTCTTGTGTTGGATTCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 500
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At1g46480  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6814 marker 6814
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)