SGN Marker SSR9

SGN-M682

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 47.619 High: 42.857
Repeat motif: ATA   Repeat number: 10
Repeat motif:    Repeat number:
Forward primer: CCCTTTGCAAGTTCTTCTTCA
Reverse primer: TTCATGAGCCAACATAGGAGG
Predicted size: 168
Derivations 
This marker was derived from EST read SGN-E120899
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43823)
Chromosome
1
Position
93.20 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44845
Forward primer (5'-3')
CCCTTTGCAAGTTCTTCTTCA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTCATGAGCCAACATAGGAGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43283)
Chromosome
1
Position
93.20 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44659
Forward primer (5'-3')
CCCTTTGCAAGTTCTTCTTCA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTCATGAGCCAACATAGGAGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-LXCHM 2007   
Map version
68 (location: 43005)
Chromosome
1
Position
49.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-LXCHM 2007

PCR data   Exp. ID 44005
Forward primer (5'-3')
CCCTTTGCAAGTTCTTCTTCA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTCATGAGCCAACATAGGAGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39302)
Chromosome
1
Position
134.00 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 31892
Forward primer (5'-3')
CCCTTTGCAAGTTCTTCTTCA
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TTCATGAGCCAACATAGGAGG
Enzymes
  
Accessions and product sizes
Approximate temperature
42°C
  
Overgo hybridization and physical mapping 
SSR9 was used as an overgo probe on plate 8 [well C10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATCCACTTCCAGTAGGTGCAACAG
B sequence
GCTGTTGATGCCATTGCTGTTGCA
AB sequence
ATCCACTTCCAGTAGGTGCAACAGCAATGG
Marker sequence
AACACATAATCATCCACTTCCAGTAGGTGCAACAGCAATGGCATCAACAG
CATGAGCAGCAGCTTCATTCATGTTAGTGGATTCAAGTATTAGTCCTCTT
CTTAATCACAATTCCAATTTAAACCAACCACTTAATTTCCCTAATTACCA
CCATAATCTAGCACCTAATTACCATCACTCTTCTTCTTCTTCACCTTATA
ATAATTTCTCCAATTTAAGAACCAATATTCTTAATTCTAGTGATCCTAAT
AATTCTTCACAAGGGAACTTAGTTCTTGATCTCACCAAAAATATGTCAAA
TAATAATCATCAATTCCCCTTTGCAAGTTCTTCTTCAAATAATCATGAAA
TTGGACATTCTAATTGGATGTCTAAATTATCTAATTATGAAGGGAATAAC
CTTTTTTCTGGTCCTAAATTACAAGGTGAACATAATAATAATAATAATAA
TAATAATAATATTCCTCCTATGTTGGCTCATGAAAATATGAGTGCAATTG
CTTCTGATCCTAAATTTAGGGT
Genomic location of SSR9  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D682 marker 682
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)