SGN Marker C2_At1g48310

SGN-M6825
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301584 (SGN)
122666 (CGN)
---
Capsicum annuumSingleSGN-U200058---
Lycopersicon CombinedSingleSGN-U238374---
Solanum tuberosumSingleSGN-U258424---
ArabidopsisSingleAt1g48310 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38187)
Chromosome
12
Position
105.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41096
Forward primer (5'-3')
AAGCTCAGTATGTGATATTGCTCAGTG
Accessions and product sizes
Solanum pennellii TA56
475
Solanum lycopersicum TA209
475
Approximate temperature
55°C
Reverse primer (5'-3')
TCTTATATACAGTAGGATGCAAGGCCTC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
425
Solanum pennellii TA56
325
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25233)
Chromosome
1
Position
17.85 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g48310  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6825 marker 6825
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)