SGN Marker C2_At1g59820

SGN-M6903
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle308400 (SGN)
126581 (CGN)
---
Lycopersicon CombinedMultipleSGN-U218533---
Solanum tuberosumSingleSGN-U250588---
ArabidopsisSingleAt1g59820 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25313)
Chromosome
1
Position
22.02 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41122
Forward primer (5'-3')
TATGATGATTGGTTCCAGTCTCTC
Accessions and product sizes
Solanum pennellii TA56
400
Solanum lycopersicum TA209
400
Approximate temperature
50°C
Reverse primer (5'-3')
TGTAGGCCATTGTACTGACATCCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 10302
Forward primer (5'-3')
TATGATGATTGGTTCCAGTCTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTAGGCCATTGTACTGACATCCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 400
Approximate temperature
50°C
  
PCR data   Exp. ID 10303
Forward primer (5'-3')
TATGATGATTGGTTCCAGTCTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTAGGCCATTGTACTGACATCCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 400
Approximate temperature
50°C
  
PCR data   Exp. ID 10304
Forward primer (5'-3')
TATGATGATTGGTTCCAGTCTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTAGGCCATTGTACTGACATCCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 400
Approximate temperature
50°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At1g59820  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6903 marker 6903
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)