SGN Marker C2_At1g60640

SGN-M6913
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U200460---
Lycopersicon CombinedSingleSGN-U225406---
Solanum tuberosumSingleSGN-U257149---
ArabidopsisSingleAt1g60640 on TAIR---
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132181)
Chromosome
2
Position
13.86 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38219)
Chromosome
2
Position
12.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39491
Forward primer (5'-3')
TCTGACAGGGGGAAATGAATCTTC
Accessions and product sizes
Solanum pennellii TA56
850
Solanum lycopersicum TA209
750
Approximate temperature
55°C
Reverse primer (5'-3')
ACTTCATTGAAAGAGCTATCTTCACTCTC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
750
Solanum pennellii TA56
850
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25324)
Chromosome
1
Position
22.34 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10315
Forward primer (5'-3')
TCTGACAGGGGGAAATGAATCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTTCATTGAAAGAGCTATCTTCACTCTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 530
Approximate temperature
55°C
  
PCR data   Exp. ID 10317
Forward primer (5'-3')
TCTGACAGGGGGAAATGAATCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTTCATTGAAAGAGCTATCTTCACTCTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 530
Approximate temperature
55°C
  
PCR data   Exp. ID 12744
Forward primer (5'-3')
TCTGACAGGGGGAAATGAATCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTTCATTGAAAGAGCTATCTTCACTCTC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12745
Forward primer (5'-3')
TCTGACAGGGGGAAATGAATCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTTCATTGAAAGAGCTATCTTCACTCTC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 12746
Forward primer (5'-3')
TCTGACAGGGGGAAATGAATCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTTCATTGAAAGAGCTATCTTCACTCTC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 12747
Forward primer (5'-3')
TCTGACAGGGGGAAATGAATCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTTCATTGAAAGAGCTATCTTCACTCTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 12748
Forward primer (5'-3')
TCTGACAGGGGGAAATGAATCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTTCATTGAAAGAGCTATCTTCACTCTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 12749
Forward primer (5'-3')
TCTGACAGGGGGAAATGAATCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTTCATTGAAAGAGCTATCTTCACTCTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 550+650
Approximate temperature
55°C
  
PCR data   Exp. ID 12750
Forward primer (5'-3')
TCTGACAGGGGGAAATGAATCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTTCATTGAAAGAGCTATCTTCACTCTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 550+650
Approximate temperature
55°C
  
PCR data   Exp. ID 12751
Forward primer (5'-3')
TCTGACAGGGGGAAATGAATCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTTCATTGAAAGAGCTATCTTCACTCTC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 12752
Forward primer (5'-3')
TCTGACAGGGGGAAATGAATCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTTCATTGAAAGAGCTATCTTCACTCTC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 12753
Forward primer (5'-3')
TCTGACAGGGGGAAATGAATCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTTCATTGAAAGAGCTATCTTCACTCTC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 32220
Forward primer (5'-3')
TCTGACAGGGGGAAATGAATCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTTCATTGAAAGAGCTATCTTCACTCTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 530
Approximate temperature
55°C
  
PCR data   Exp. ID 32813
Forward primer (5'-3')
TCTGACAGGGGGAAATGAATCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTTCATTGAAAGAGCTATCTTCACTCTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 32814
Forward primer (5'-3')
TCTGACAGGGGGAAATGAATCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTTCATTGAAAGAGCTATCTTCACTCTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 32815
Forward primer (5'-3')
TCTGACAGGGGGAAATGAATCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTTCATTGAAAGAGCTATCTTCACTCTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 550+650
Approximate temperature
55°C
  
PCR data   Exp. ID 32816
Forward primer (5'-3')
TCTGACAGGGGGAAATGAATCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTTCATTGAAAGAGCTATCTTCACTCTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 550+650
Approximate temperature
55°C
  
PCR data   Exp. ID 10318
Forward primer (5'-3')
TCTGACAGGGGGAAATGAATCTTC
Digested band sizes (using EcoRV)
Solanum pennellii LA716: 400
Solanum lycopersicum LA925: 530
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTTCATTGAAAGAGCTATCTTCACTCTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI, DraI, EcoRV, DpnII
All possible enzymes for lycopersicum and pimpinellifolium: TaqI
  
Accessions and product sizes
Solanum lycopersicum LA925: 530
Solanum pennellii LA716: 530
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At1g60640  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6913 marker 6913
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)