SGN Marker C2_At1g61150

SGN-M6920
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle306666 (SGN)
126415 (CGN)
---
Capsicum annuumSingleSGN-U204128---
Lycopersicon CombinedMultipleSGN-U217595---
Solanum tuberosumSingleSGN-U257031---
ArabidopsisSingleAt1g61150 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49217)
Chromosome
3
Position
1.16 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47148)
Chromosome
3
Position
20.00 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46598)
Chromosome
9
Position
63.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46447)
Chromosome
9
Position
57.60 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38220)
Chromosome
3
Position
25.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39492
Forward primer (5'-3')
ATGGAAAGATTGAGGAGGCTTTGGAG
Accessions and product sizes
Solanum pennellii TA56
475
Solanum lycopersicum TA209
475
Approximate temperature
55°C
Reverse primer (5'-3')
ATCTTCAATAGGCTTGGAAGCTTTGG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
225
Solanum pennellii TA56
300
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25331)
Chromosome
1
Position
22.55 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g61150  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6920 marker 6920
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)