Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker SSR22

SGN-M695

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 60
Repeat motif: AT   Repeat number: 11
Repeat motif:    Repeat number:
Forward primer: GATCGGCAGTAGGTGCTCTC
Reverse primer: CAAGAAACACCCATATCCGC
Predicted size: 217
Derivations 
This marker was derived from EST read SGN-E90470
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 42990)
Chromosome
3
Position
26.80 cM
Confidence
uncalculated
Protocol
SSR


Tomato-LXCHM 2007

PCR data   Exp. ID 43990
Forward primer (5'-3')
GATCGGCAGTAGGTGCTCTC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CAAGAAACACCCATATCCGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39191)
Chromosome
3
Position
99.00 cM
Confidence
I(LOD2)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 47
Forward primer (5'-3')
GATCGGCAGTAGGTGCTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CAAGAAACACCCATATCCGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 206+218
Solanum lycopersicum LA925: 218+218
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR22 was used as an overgo probe on plate 1 [well D12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AAGCTATGATGGCTCCAGGGATTC
B sequence
GAAGAACCACCGTAGAGAATCCCT
AB sequence
AAGCTATGATGGCTCCAGGGATTCTCTACG
Marker sequence
CTCTTCTCTGCTCCAACACACCCTCTTTGCTCTGCTTTATTCCCAAAAAA
AAATAAATCAACAAAATTTCTGTTTTTGGTTCTGGAACTTGGCTATCTTT
TTTTTTTGGTTCATAATCATATCCTTGTATTGAATTTGTAAGCAAGGGTG
ATGATGTTTATGGTGATCGGCAGTAGGTGCTCTCACACTTCCCACATCAC
TGAAATCATAATCACAAGCTTCTTTCGCCACAAGCTATAGATCTTTACTA
ATTCCATATAGTATATAGTTTTAATACAAGAAAACAATATATATATATAT
ATATATATTAAAGGGGGGTATTTATCAAGAACCCCAAATTCTTAATTACA
TAACGAAACGAGCGGATATGGGTGTTTCTTGAAAAGATCTCTGTTTTATA
ATTTAAAAAAATTTGTCTGTAGAATTCGAAGCTATGATGGCTCCAGGGAT
TCTCTACGGTGGTTCTTCTAATTTCGATGGCGTTTTTACTCAAAAACAGA
GAGACGTGTTTTCTTCATCTACTGCACCGAAAGGGCATCTTGGTTCCCTT
TTTGCCCCTGCCTCTTCTTCTTCTAATTTCTTGGGATCCAGTTCTATGGT
GAGTTTTCGCGGTGTTAATGGAGGGAAGAGATCATTCTTTGATTCGTTCG
ATCAGGATGACAATGAAGCTGATGAATTGGGGGAATATCTTT
Genomic location of SSR22  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D695 marker 695
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)