SGN Marker C2_At1g67840

SGN-M6989
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310634 (SGN)
132428 (CGN)
---
Lycopersicon CombinedSingleSGN-U220365---
Solanum tuberosumSingleSGN-U250246---
ArabidopsisSingleAt1g67840 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25402)
Chromosome
1
Position
25.44 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41146
Forward primer (5'-3')
ACCGAGTGTTGATTTTCAGAGACTTTG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
ATCACATAGCTTCCAGCTGGTCTTAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g67840  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6989 marker 6989
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)