SGN Marker SSR28

SGN-M701

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 45.455 High: 40
Repeat motif: CT   Repeat number: 13
Repeat motif:    Repeat number:
Forward primer: ACCAAATGGAAATGGGTCAA
Reverse primer: CCCTAAGACTAACGACAACCAA
Predicted size: 164
Derivations 
This marker was derived from EST read SGN-E112891
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39204)
Chromosome
9
Position
50.45 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 32012
Forward primer (5'-3')
ACCAAATGGAAATGGGTCAA
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CCCTAAGACTAACGACAACCAA
Enzymes
  
Accessions and product sizes
Approximate temperature
40°C
  
Overgo hybridization and physical mapping 
SSR28 was used as an overgo probe on plate 7 [well B2]

Plausible BAC Matches:   P213P18,   P232O16,   P215M05,   P125I08,   P015N07,   P296C16,   P196E03,   P137E13,   P206D22,   P076I22,   P223M05,   P072K04,   P301E09,   P200F10,   P254K21,   P096G13,   P315G05,   P248E17,   P294L24

 Overgo Sequences

A sequence
GTGCATTGATCCATTTTCCTTCTG
B sequence
AAAAGCTACCGACCCACAGAAGGA
AB sequence
GTGCATTGATCCATTTTCCTTCTGTGGGTC
Marker sequence
GATTAATTCATGTGATATGTAAGTGTGCATTGATCCATTTTCCTTCTGTG
GGTCGGTAGCTTTTGCATAGAACAAGTTGTAGATTTATTGTTATTTTGTG
CTGAACCGAGTTGCTCAATA
Genomic location of SSR28  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D701 marker 701
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)