SGN Marker C2_At1g76150

SGN-M7066
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeMultiple306023 (SGN)
130273 (CGN)
---
Capsicum annuumSingleSGN-U200236---
Lycopersicon CombinedSingleSGN-U218660---
Solanum tuberosumSingleSGN-U251332---
ArabidopsisSingleAt1g76150 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46613)
Chromosome
12
Position
45.80 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41355)
Chromosome
12
Position
94.10 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43331
Forward primer (5'-3')
TCTGGTGAACGGCTATGCATGAAC
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
AAGGCTGAGATGACTTTGAGAACC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38265)
Chromosome
12
Position
85.30 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39535
Forward primer (5'-3')
TCTGGTGAACGGCTATGCATGAAC
Accessions and product sizes
Solanum lycopersicum TA209
750
Solanum pennellii TA56
750
Approximate temperature
53°C
Reverse primer (5'-3')
AAGGCTGAGATGACTTTGAGAACC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
700
Solanum pennellii TA56
750
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25480)
Chromosome
1
Position
28.58 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10442
Forward primer (5'-3')
TCTGGTGAACGGCTATGCATGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGGCTGAGATGACTTTGAGAACC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 10443
Forward primer (5'-3')
TCTGGTGAACGGCTATGCATGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGGCTGAGATGACTTTGAGAACC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 10444
Forward primer (5'-3')
TCTGGTGAACGGCTATGCATGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGGCTGAGATGACTTTGAGAACC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 12834
Forward primer (5'-3')
TCTGGTGAACGGCTATGCATGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGGCTGAGATGACTTTGAGAACC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 200+400
Approximate temperature
55°C
  
PCR data   Exp. ID 12835
Forward primer (5'-3')
TCTGGTGAACGGCTATGCATGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGGCTGAGATGACTTTGAGAACC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 200+400
Approximate temperature
55°C
  
PCR data   Exp. ID 12836
Forward primer (5'-3')
TCTGGTGAACGGCTATGCATGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGGCTGAGATGACTTTGAGAACC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 200+400
Approximate temperature
55°C
  
PCR data   Exp. ID 12837
Forward primer (5'-3')
TCTGGTGAACGGCTATGCATGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGGCTGAGATGACTTTGAGAACC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 200+400
Approximate temperature
55°C
  
PCR data   Exp. ID 12838
Forward primer (5'-3')
TCTGGTGAACGGCTATGCATGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGGCTGAGATGACTTTGAGAACC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 200+400
Approximate temperature
55°C
  
PCR data   Exp. ID 12839
Forward primer (5'-3')
TCTGGTGAACGGCTATGCATGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGGCTGAGATGACTTTGAGAACC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 200+400
Approximate temperature
55°C
  
PCR data   Exp. ID 12840
Forward primer (5'-3')
TCTGGTGAACGGCTATGCATGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGGCTGAGATGACTTTGAGAACC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 200+400
Approximate temperature
55°C
  
PCR data   Exp. ID 12841
Forward primer (5'-3')
TCTGGTGAACGGCTATGCATGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGGCTGAGATGACTTTGAGAACC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 200+400
Approximate temperature
55°C
  
PCR data   Exp. ID 12842
Forward primer (5'-3')
TCTGGTGAACGGCTATGCATGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGGCTGAGATGACTTTGAGAACC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 200+400
Approximate temperature
55°C
  
PCR data   Exp. ID 12843
Forward primer (5'-3')
TCTGGTGAACGGCTATGCATGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGGCTGAGATGACTTTGAGAACC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 200+400
Approximate temperature
55°C
  
PCR data   Exp. ID 32611
Forward primer (5'-3')
TCTGGTGAACGGCTATGCATGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGGCTGAGATGACTTTGAGAACC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 200+400
Approximate temperature
55°C
  
PCR data   Exp. ID 32858
Forward primer (5'-3')
TCTGGTGAACGGCTATGCATGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGGCTGAGATGACTTTGAGAACC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 200+400
Approximate temperature
55°C
  
PCR data   Exp. ID 32859
Forward primer (5'-3')
TCTGGTGAACGGCTATGCATGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGGCTGAGATGACTTTGAGAACC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 200+400
Approximate temperature
55°C
  
PCR data   Exp. ID 32860
Forward primer (5'-3')
TCTGGTGAACGGCTATGCATGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGGCTGAGATGACTTTGAGAACC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 200+400
Approximate temperature
55°C
  
PCR data   Exp. ID 32861
Forward primer (5'-3')
TCTGGTGAACGGCTATGCATGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGGCTGAGATGACTTTGAGAACC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 200+400
Approximate temperature
55°C
  
PCR data   Exp. ID 32862
Forward primer (5'-3')
TCTGGTGAACGGCTATGCATGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGGCTGAGATGACTTTGAGAACC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 200+400
Approximate temperature
55°C
  
PCR data   Exp. ID 10445
Forward primer (5'-3')
TCTGGTGAACGGCTATGCATGAAC
Digested band sizes (using DraI)
Solanum lycopersicum LA925: 100
Solanum pennellii LA716: 150
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGGCTGAGATGACTTTGAGAACC
Enzymes
All possible enzymes for pennellii and and lycopersicum: DraI
  
Accessions and product sizes
Solanum lycopersicum LA925: 150
Solanum pennellii LA716: 150
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At1g76150  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7066 marker 7066
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)