SGN Marker C2_At1g79810

SGN-M7116
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle311804 (SGN)
130471 (CGN)
---
Lycopersicon CombinedMultipleSGN-U216394---
Solanum tuberosumSingleSGN-U251374---
ArabidopsisSingleAt1g79810 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41362)
Chromosome
6
Position
90.40 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43338
Forward primer (5'-3')
ATATGAACCAGAACTTGATGCTTTTC
Accessions and product sizes
Approximate temperature
60°C
Reverse primer (5'-3')
ACGAGCCCATATATATTGACCACCAAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38277)
Chromosome
6
Position
44.30 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

Map: Arabidopsis COSII   
Map version
44 (location: 25530)
Chromosome
1
Position
30.03 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At1g79810  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7116 marker 7116
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)