SGN Marker C2_At2g06005

SGN-M7178
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle312067 (SGN)
131794 (CGN)
---
Lycopersicon CombinedSingleSGN-U227529---
Solanum tuberosumSingleSGN-U249314---
ArabidopsisSingleAt2g06005 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38294)
Chromosome
12
Position
34.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39559
Forward primer (5'-3')
AGATGGCGTTGTTGCAATATCAGC
Accessions and product sizes
Solanum pennellii TA56
310
Solanum lycopersicum TA209
310
Approximate temperature
55°C
Reverse primer (5'-3')
TCATTACATCTTTCGTATTTGCTCAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25593)
Chromosome
2
Position
2.33 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10527
Forward primer (5'-3')
AGATGGCGTTGTTGCAATATCAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATTACATCTTTCGTATTTGCTCAAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 10528
Forward primer (5'-3')
AGATGGCGTTGTTGCAATATCAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATTACATCTTTCGTATTTGCTCAAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 10529
Forward primer (5'-3')
AGATGGCGTTGTTGCAATATCAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATTACATCTTTCGTATTTGCTCAAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 10530
Forward primer (5'-3')
AGATGGCGTTGTTGCAATATCAGC
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 190+200
Solanum pennellii LA716: 350
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATTACATCTTTCGTATTTGCTCAAG
Enzymes
All possible enzymes for pennellii and and lycopersicum: HinfI
All possible enzymes for lycopersicum and pimpinellifolium: HinfI
  
Accessions and product sizes
Solanum pennellii LA716: 400
Solanum lycopersicum LA925: 400
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At2g06005F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text

Genomic location of C2_At2g06005  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7178 marker 7178
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)